Labshake search
Citations for Zymo Research :
4801 - 4850 of 9639 citations since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... The DNA was bisulfited-converted using EZ DNA Methylation-Gold™ kit (Zymo research) in accordance with the manufacture’s protocol ...
-
bioRxiv - Molecular Biology 2022Quote: ... the reaction was stopped by adding MN Stop Buffer and the nucleosomal DNA isolation was carried out according to the kit protocol (D5220, Zymo Research). Illumina TruSeq PCR free DNA library was prepared without bead-based size selection followed by a preparative size selection on the PippinHT to remove non- ligated adaptors and library molecules with inserts >500 bp.
-
bioRxiv - Molecular Biology 2022Quote: ... These 36 pools were then purified (Zymo Research Z4004) and quantified using Qubit dsDNA BR (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2022Quote: ... at 30°C for 30 min and removed by RNA Clean & Concentrator (Zymo Research). Reverse transcription reactions including the ligated RNA above ...
-
bioRxiv - Microbiology 2022Quote: ... and Direct-zol RNA MiniPrep (Zymo Research Corporation) according to the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2022Quote: ... Bisulfite conversion had been carried out with the EZ DNA Methylation-Lightning Kit (Zymo Research, Irvine, CA, USA). Libraries were quantified using the Kapa Illumina GA with Revised Primers-SYBR Fast Universal kit (Kapa Biosystems ...
-
bioRxiv - Synthetic Biology 2022Quote: ... gel extracted with Zymoclean Gel DNA Recovery kit (Zymo Research), and submitted for Sanger sequencing (Genewiz) ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Genomic DNA was extracted from sorted cells using the Genomic DNA Clean & Concentrator kit (Zymo Research). PCR fragments were amplified using KAPA HiFi HotStart DNA Polymerase with 2X Master Mix (Roche) ...
-
bioRxiv - Microbiology 2022Quote: ... Prior to library preparation the DNA concentration of each sample was normalized and 20pg of spike-in gDNA was added (Zymo Research High Bacterial Load Spike-in), which contains gDNA from the bacterial species Imchella halotolerans and Allobacillus halotolerans ...
-
bioRxiv - Microbiology 2022Quote: ... Urine pellets were resuspended in 750 μL of DNA/RNA Shield (Zymo Research), transferred to a bead beating tube ...
-
bioRxiv - Microbiology 2022Quote: ... the maximum volume of sample was collected and transferred to a new microcentrifuge tube with DNA/RNA lysis buffer (Zymo). Nucleic acids were purified via the Zymo Research DNA/RNA microbiome miniprep kit per the manufacturer’s instruction ...
-
bioRxiv - Microbiology 2022Quote: ... The size of 150-400 nt was cut and recovered by Zymo DNA agarose gel extraction kit (Zymo Research). DNA libraries were quantified ...
-
bioRxiv - Microbiology 2022Quote: ... The size of 150-400 nt was cut and recovered by Zymo DNA agarose gel extraction kit (Zymo Research) ...
-
bioRxiv - Microbiology 2022Quote: ... and then purified with RNA Clean & Concentrator (Zymo Research). The purified ssDNA was mixed with forward primer (5’-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG ATCT-3’ ...
-
bioRxiv - Microbiology 2022Quote: ... followed by mixing with 5 µl 1M Tris-HCl (pH 7.5) before RNA Clean & Concentrator (Zymo Research). The purified cDNA was then ligated with 5’ adapter (5’/5Phos/AGATCGGAAGAGCGTCGTGTAGCTCTTCCGATCTN10/3SpC3/-3’ with 1:20 molar ratio of RNA to 5’adapter ...
-
bioRxiv - Microbiology 2022Quote: ... and then purified with RNA Clean & Concentrator (Zymo Research). 3’ dephosphorylation reactions included 7 µl fragmented sample ...
-
bioRxiv - Developmental Biology 2022Quote: ... DNA was extracted and purified using the ChIP DNA Clean and Concentrator kit (Zymo Research, #D5201) using the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2022Quote: ... bacterial DNA was extracted using ZymoBIOMICS-96 MagBead DNA kit (Zymo Research Irvine, CA). The DNA samples were prepared for targeted sequencing with the Quick-16S NGS library Prep kit and 16S primer set V3-V4 (Zymo Research Irvine ...
-
bioRxiv - Neuroscience 2022Quote: RNA extraction was performed using DirectZol RNA-Miniprep Kit (Zymo Research Inc.), following the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2022Quote: ... and total RNA was extracted using the Quick-RNA Miniprep Kit (Zymo; Cat. No. R1054). cDNA was synthesized with the SensiFAST cDNA Synthesis Kit (Bioline ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Samples were cleaned with DNA Clean & Concentrator columns (Zymo Research #D4004) and libraries were prepared using NEBNext Ultra II FS DNA Library Prep Kit for Illumina (New England Biolabs #E7805 ...
-
bioRxiv - Physiology 2022Quote: ... using the Direct-zol RNA miniprep kit (Zymo Research, cat#R2071). cDNA prepared with iScript cDNA Synthesis (Bio-Rad ...
-
bioRxiv - Molecular Biology 2022Quote: ... the sample was further purified using the RNA Clean & Concentrator-5 kit (Zymo Research) and DNase treated subsequently.
-
bioRxiv - Molecular Biology 2022Quote: ... Right after precipitation the sample was further purified using the RNA Clean & Concentrator-5 kit (Zymo Research) and DNase treated subsequently.
-
bioRxiv - Molecular Biology 2022Quote: ... RNA was cleaned up either with the RNA Clean & Concentrator-5 kit (Zymo Research) or by Ethanol precipitation.
-
bioRxiv - Molecular Biology 2022Quote: ... we purified RNA samples by RNA Clean & Concentrator-5 kit (Zymo Research). If this kit was used prior DNase treatment ...
-
bioRxiv - Molecular Biology 2022Quote: ... TurboDNase treatment as described above usually removes most genomic DNA and small fragments of DNA that could prime as random primers (detectable by ‘no RT primer’ control) are cleared away efficiently by the RNA Clean & Concentrator-5 kit (Zymo Research). Hence ...
-
bioRxiv - Molecular Biology 2022Quote: ... We then digested the template DNA using TurboDNase at a concentration of 0.1 U/μl in 200 μl and cleaned up the reaction using the RNA Clean & Concentrator-25 kit (Zymo Research). Finally ...
-
bioRxiv - Molecular Biology 2022Quote: ... The sample was further purified using the RNA Clean & Concentrator-5 kit (Zymo Research) and DNase treated subsequently (details in ‘RNA cleanup’ section).
-
bioRxiv - Molecular Biology 2022Quote: ... We followed the PCR with an agarose gel extraction and a column purification using the Oligo Clean & Concentrator kit (Zymo Research). The DNA template was then in vitro transcribed using the HiScribe T7 high yield RNA synthesis kit (NEB ...
-
bioRxiv - Molecular Biology 2022Quote: ... clean-up using the RNA Clean & Concentrator-25 kit (Zymo Research), agarose gel analysis and quantification with the Qubit RNA BR assay followed.
-
bioRxiv - Genomics 2022Quote: ... Genomic DNA from FACS enriched LEps were extracted using Quick-DNA Microprep kit (Zymo Research). Whole-genome bisulfite sequencing (WGBS-seq ...
-
bioRxiv - Genomics 2022Quote: Total RNA was isolated using Quick-RNA Microprep kit (Zymo Research) from FACS sorted young (n = 10 ...
-
bioRxiv - Genomics 2022Quote: ... Genomic DNA was bisulfite converted using the Zymo EZ DNA methylation kit (Zymo Research) per manufacturer’s protocol ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... and isolated in large quantities using a ZymoPURE-EndoZero Maxiprep kit (Zymo Research, Irvine, CA) or a HiSpeed Plasmid Maxi Kit (Qiagen) ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... were homogenized in RNA STAT-60 (Tel-Test, Inc., Friendswood, TX) and total RNA purified using a Direct-zol RNA miniprep kit (Zymo Research). We used an RNA Clean and Concentrator Kit (Zymo Research ...
-
bioRxiv - Neuroscience 2022Quote: ... The RNA products were purified by an RNA cleanup purification kit (Zymo Research, R1015). The concentrations of the purified RNA samples were measured by nanodrop and the expected length was analyzed by TapeStation.
-
bioRxiv - Neuroscience 2022Quote: Total RNA from LCLs was extracted using Direct-Zol RNA MiniPrep (Zymo Research ,R2052) according to manufacturer instructions ...
-
bioRxiv - Developmental Biology 2022Quote: ... The purified DNA was then bisulfite converted using the EZ DNA Methylation-Gold Kit (Zymo, D5005).
-
bioRxiv - Developmental Biology 2022Quote: ... and 1 µL DNA Degradase Plus enzyme (Zymo Research, Freiburg, Germany) were added ...
-
bioRxiv - Developmental Biology 2022Quote: ... The DNA digestion efficiency was monitored by using 100 ng 5-methylcytosine and 5-hydroxymethylcytosine DNA standard sets (Zymo Research) in parallel under identical conditions ...
-
bioRxiv - Genomics 2022Quote: ... total RNA is harvested using Direct-zol RNA MiniPrep kit (Zymo Research). RNA concentration and integrity was assessed using Nanodrop.
-
bioRxiv - Immunology 2022Quote: ... RNA from magnet-enriched cells was purified by Zymo Quick-RNA Viral Kit (Zymo Research ...
-
bioRxiv - Immunology 2022Quote: ... RNA from magnet-enriched cells was purified by Zymo Quick-RNA Viral Kit (Zymo Research, Irvine, CA). The larger of either 1μg of RNA or 5μL of RNA were used as a template for cDNA synthesis by the ImProm-II reverse transcriptase system (Promega ...
-
bioRxiv - Immunology 2022Quote: ... 16S bacterial rDNA was isolated from stool and intestinal contents with a ZymoBIOMICS DNA kit (Zymo Research, Irvine, CA) kit ...
-
bioRxiv - Cancer Biology 2022Quote: ... Direct-zol Mini Prep kit (Zymo research) reagents and protocol were used to complete RNA extraction ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: Total RNA was extracted using Direct-zol™ RNA MiniPrep Kit (Zymo Research) before converted to cDNA ...
-
bioRxiv - Systems Biology 2022Quote: ... and plasmid DNA was extracted with multiple ZymoPURE II Plasmid Midiprep columns (Zymo Research cat. no. D4200). Library coverage was estimated by counting the number of bacterial colonies on a 1:1,000 dilution plate and a 1:10,000 dilution plate ...
-
bioRxiv - Molecular Biology 2022Quote: ... The DNA sample was then extracted with chloroform and the water layer was further purified using DNA Clean & Concentrator kit (Cat. D4029, Zymo Research, California, U.S.). The samples were then sent for next generation sequencing using the BGI-Seq platform (BGI ...
-
bioRxiv - Cell Biology 2022Quote: ... 8 were performed with the YeaStar RNA Kit (Zymo Research) following the instructions of the given protocol ...