Labshake search
Citations for Zymo Research :
5051 - 5100 of 9639 citations since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: Total RNA was isolated using the Direct-zol™ RNA kit (Zymo Research). RNA was quantified using a Qubit RNA Assay Kit (Life Technologies) ...
-
bioRxiv - Molecular Biology 2022Quote: ... RNA was isolated using a Direct-zol™ RNA Mini Prep Kit (Zymo Research) and treated with Turbo DNase I (Thermo Fisher Scientific).
-
bioRxiv - Molecular Biology 2022Quote: ... The product was cleaned up using RNA Clean & Concentrator-5 kit (ZYMO, R1013) and added into 20 μl of reverse transcription and strand-switching reaction containing 100 nM custom primer (5’ - phos/ ACTTGCCTGTCGCTCTATCTTCATTGATGGTGCCTACAG - 3’) ...
-
bioRxiv - Molecular Biology 2022Quote: ... bisulfite conversion was performed using EZ DNA Methylation Gold kit (Zymo Research, cat. No. D5006) or EM-seq Conversion Module (NEB ...
-
bioRxiv - Molecular Biology 2022Quote: Single-stranded cfDNA methylation sequencing libraries were prepared as above after input cfDNA was converted using either the EZ DNA Methylation Gold kit (Zymo Research, cat. No. D5006) or the EM-seq Conversion Module (NEB ...
-
bioRxiv - Molecular Biology 2022Quote: ... rRNA-depleted RNA was purified by RNA Clean & Concentrator-5 kit (ZYMO, R1013) and then ligated to 50 pmol 3’ adapter (5’-rAppCTGTAGGCACCATCAAT - NH2-3’ ...
-
bioRxiv - Molecular Biology 2022Quote: ... All the steps from here were optimized from the standard protocol provided with the EZ Nucleosomal DNA Prep Kit (D5220, Zymo Research). Briefly ...
-
bioRxiv - Molecular Biology 2022Quote: ... Chromatin immunoprecipitation was performed with the Zymo-Spin ChIP Kit (Zymo Research, Freiburg, Germany) according to manufacturer’s protocol Following ChIP-valuated antibodies were used for precipitation ...
-
bioRxiv - Molecular Biology 2022Quote: ... After purification with the RNA Clean and Concentrator-5 kit (Zymo Research, Freiburg, Germany), quantity and quality was tested with Nanodrop 2000 (Avantor ...
-
bioRxiv - Plant Biology 2022Quote: Extraction of total RNA from Arabidopsis seedlings and Marchantia spores was carried out using the Direct-Zol RNA MINIprep kit (Zymo Research) following the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2022Quote: ... and V3-V4 16S primers (Zymo Research, Irvine, CA). The sequencing library was prepared using real-time PCR ...
-
bioRxiv - Neuroscience 2022Quote: ... Taxonomy assignment was performed using Uclust from Qiime (v.1.9.1) and referenced with the Zymo Research Database (Zymo Research, Irvine, CA).
-
bioRxiv - Neuroscience 2022Quote: ... and 16S targeted sequencing was completed using the Quick-16S™ NGS Library Prep Kit (Zymo Research, Irvine, CA) and V3-V4 16S primers (Zymo Research ...
-
bioRxiv - Neuroscience 2022Quote: ... and RNA was extracted using the Direct-zol™ RNA MiniPrep kit (cat# R2050, Zymo Research) with RNA samples treated in-column with DNase I (cat# R2050 ...
-
bioRxiv - Neuroscience 2022Quote: ... The final pooled library was cleaned with the Select-a-Size DNA Clean & Concentrator™ (Zymo Research, Irvine, CA) which was then quantified with TapeStation® (Agilent Technologies ...
-
bioRxiv - Neuroscience 2022Quote: ... DNA extraction was performed using the ZymoBIOMICS ®-96 MagBead DNA Kit (Zymo Research, Irvine, CA) and 16S targeted sequencing was completed using the Quick-16S™ NGS Library Prep Kit (Zymo Research ...
-
bioRxiv - Neuroscience 2022Quote: ... with RNA samples treated in-column with DNase I (cat# R2050, Zymo Research) as described by the manufacturer ...
-
bioRxiv - Neuroscience 2022Quote: ... and RNA Clean & ConcentratorTM-5 (Zymo Research, #R1014). Jun expression was analyzed by qRT-PCR with the primers ...
-
bioRxiv - Systems Biology 2022Quote: ... Total DNA extractions were performed for tea broth and pellicle samples using Quick-DNA Fecal/soil Microbe Miniprep kit (ZYMO Research Corp.) according to the manufacturer’s instructions.
-
bioRxiv - Immunology 2022Quote: ... Total RNA extraction from cells and DNase treatment were performed with Direct-zol RNA extraction kit (Zymo Research). Viral genome equivalents were determined using a previously published assay specific for both SARS-CoV and SARS-CoV-2 E gene (Corman et al. ...
-
bioRxiv - Immunology 2022Quote: ... placed in a vial with DNA/RNA Shield™ solution (Zymo Research), and stored at -70°C until further processing.
-
bioRxiv - Immunology 2022Quote: ... RNA was extracted using the Quick DNA/RNA Mini-Prep Plus kit (catalog # D7003; Zymo, Irvine, CA, USA) with on-column DNase digestion ...
-
bioRxiv - Immunology 2022Quote: ... cells were harvested with Direct-zol RNA Mini Prep kit (catalog # R2052, Zymo, Irvine, CA) according to manufacturer standard protocol ...
-
bioRxiv - Immunology 2022Quote: DNA extraction: DNA was extracted from control-RNP and IFNA-targeted cells using Quick-DNATM Microprep kit (Zymo Research, # D3021), and DNA concentration was calculated on Nanodrop OneC (Thermofisher).
-
bioRxiv - Immunology 2022Quote: ... RNA was extracted using the Direct-zol RNA MiniPrep kit (Zymo research), and subsequent reverse transcription was performed with 200ng of RNA using the High-Capacity RNA-to-cDNA kit (applied biosystems) ...
-
bioRxiv - Immunology 2022Quote: ... PCR amplification products were later purified using DNA Clean & ConcentratorTM −5 (Zymo Research, # D4004) following the protocol provided by the manufacturer.
-
bioRxiv - Microbiology 2022Quote: ... or Zymoclean Gel DNA Recovery Kits (ZYMO Research) to remove primer dimers and unspecific products ...
-
bioRxiv - Microbiology 2022Quote: ... and Direct-zol RNA MiniPrep kit (Zymo Research). For relative quantification of viral RNA and host mRNAs ...
-
bioRxiv - Plant Biology 2022Quote: Total RNA was isolated from roots using a ZR Plant RNA MiniPrep kit (Zymo research). The RNA concentration was estimated spectrally (Nano Drop ND-1000 ...
-
bioRxiv - Plant Biology 2022Quote: ... officinalis nodule tissue was extracted using Direct-zol RNA miniprep kits (ZYMO Research) according to the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2022Quote: ... libraries were prepared with the Pico Methyl-Seq Library Prep Kit (Zymo Research #D5456) and sequenced by the next Generation Sequencing Facility (Vienna BioCenter Core Facilities) ...
-
bioRxiv - Plant Biology 2022Quote: ... The resulting amplicons were purified using Zymoclean Gel DNA Recovery Kit (Zymo Research). The amplicons were sent for Sanger sequencing (Eurofins Genomics ...
-
bioRxiv - Plant Biology 2022Quote: ... and a Zymo Direct-zol RNA miniprep kit (Zymo). RNA concentrations and quality were initially checked using a Nanodrop and Qubit ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Fragments were then cleaned using DNA Clean & Concentrator-5 Kit (Zymo Research) before transforming to R ...
-
bioRxiv - Synthetic Biology 2022Quote: ... to remove the template and subsequently cleaned up with a DNA cleanup kit (Zymo Research) before Gibson assembly ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Each tube was processed with the ZymoPURE II Plasmid Midiprep Kit (Zymo Research). The resulting midipreps were pooled and a dilution of 10 ng/μL was prepared ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Gel extraction was done using the Zymoclean Gel DNA Recovery Kit (Zymo Research) according to the manufacturer’s instructions.
-
bioRxiv - Synthetic Biology 2022Quote: The 2 final 15kb fragments were gel extracted via agarose gel electrophoresis and purified with the Large Fragment DNA Recovery Kit (Zymo Research) and eluted in water ...
-
bioRxiv - Synthetic Biology 2022Quote: ... putida KT2440 using Zymo Quick gDNA miniprep kit (Zymo Research). Zymoclean Gel DNA recovery kit (Zymo Research ...
-
bioRxiv - Synthetic Biology 2022Quote: ... coli using GeneJet plasmid miniprep kit (ThermoScientific) or ZymoPURE plasmid midiprep kit (Zymo Research). Sequences of all plasmids were confirmed using Sanger sequencing performed by Eurofins Genomics ...
-
bioRxiv - Synthetic Biology 2022Quote: ... coli Transformation Kit & Buffer Set (Zymo Research ...
-
bioRxiv - Physiology 2022Quote: ... Bisulfite conversion was performed with a EZ DNA Methylation-Gold Kit (Zymo Research) followed by PCR amplification with NEBNext Multiplex Oligos (New England Biolabs) ...
-
bioRxiv - Systems Biology 2022Quote: ... followed by purification and enrichment using the RNA Clean and Concentrator™ kit (R1018, Zymo). The efficiency of the total RNA purification and DNA removal was verified using the NanoDrop™ 1000 instrument (Thermo Scientific ...
-
bioRxiv - Systems Biology 2022Quote: ... and purified using a DNA Clean and Concentrate kit (D4004, Zymo). The final product was eluted in nuclease-free H2O ...
-
bioRxiv - Physiology 2022Quote: ... DNA was extracted from packed red blood cells (PRBCs) and frozen tissue samples (liver, gonad) using a commercially available DNA extraction kit (Zymo quick-DNA miniprep plus kit) as described previously ...
-
bioRxiv - Physiology 2022Quote: ... and RNA was isolated using the Direct-zol RNA Miniprep Plus Kit (Zymo Research), with on-column DNase I treatment.
-
bioRxiv - Physiology 2022Quote: ... RNA was isolated using Direct-zol (Zymo Research). RNA was transcribed to cDNA via High-Capacity cDNA Reverse Transcription Kit (ThermoFisher) ...
-
bioRxiv - Physiology 2022Quote: ... RNA was isolated using Direct-zol RNA Miniprep Kit (Zymo Research), according to manufacturers’ instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... RNA was isolated from each fraction using Direct-zol RNA kit (Zymo Research), and 200 ng of RNA from each compartment was used for reverse transcription with random primers as above ...
-
bioRxiv - Molecular Biology 2022Quote: ... or Direct-zol RNA kit (Zymo Research), and treated in-column with DNase I following the manufacturer’s recommendations ...