Labshake search
Citations for Zymo Research :
251 - 300 of 6356 citations for Mouse T cell receptor alpha chain C region TCRA ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: BV2 cells were collected in RNA lysis buffer (from Zymo Research Quick-RNA Microprep kit) and RNA extraction performed using Zymo Research Quick-RNA Microprep kit (Zymo Research #R1051) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Cells were collected in TRIzol and RNA was isolated using DirectZol Miniprep Plus kit (ZYMO) with on-column DNase I digestion ...
-
bioRxiv - Cell Biology 2023Quote: ... genomic DNA was extracted from ∼3×106 cells by using Quick-DNA Kit (Zymo Research) according to manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2023Quote: ... The cDNAs of every single cell were purified using the DNA Clean & Concentrator Kit (Zymo) and loaded and run on 2% agarose gels ...
-
bioRxiv - Cancer Biology 2023Quote: ... and cell pellets were subsequently processed for RNA extraction using a kit (R2052, Zymo Research) as per manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2023Quote: ... Cells were sorted directly into RNA lysis buffer (Zymo Research Quick RNA Micro kit, S1050) for isolation of RNA.
-
bioRxiv - Microbiology 2023Quote: ... Genomic DNA extraction was performed on cell pellets using a gDNA miniprep kit (Zymo #D3024). Amplicon libraries of the pInt_kan-gal locus junction were prepared in two rounds of PCR ...
-
bioRxiv - Bioengineering 2023Quote: Genomic DNA was extracted from cells using Quick-DNA Miniprep Plus Kit (Zymo Research, D4068). An approximately 500bp fragment flanking the gRNA target site in the genome of engineered or WT cells was amplified by PCR with primers designed through NCBI Genome Data Viewer and Primer-BLAST (Supplementary Table 5) ...
-
bioRxiv - Immunology 2023Quote: ... RNA was isolated from cells using Quick-RNA Micro-prep kit (Zymo; Cat. No. R1051). Then ...
-
bioRxiv - Biochemistry 2023Quote: Cells were lysed and total RNA collected using the Quick-RNA Miniprep kit from Zymo Research (R1055 ...
-
bioRxiv - Molecular Biology 2023Quote: Genomic DNA was extracted from cells using the Quick-DNA Miniprep Kit (Zymo Research # D3024). 40ng of genomic DNA was then used for PCR amplification for 25μl reaction ...
-
bioRxiv - Cancer Biology 2023Quote: ... gDNA was extracted from the cells using the Quick-DNA Midiprep Plus Kit (Zymo Research), and one-step PCR was performed to amplify and add barcodes to the integrated crRNA sequences ...
-
bioRxiv - Microbiology 2023Quote: ... Competent Salmonella TE3006 cells were prepared using the Zymo Mix and Go kit (Zymo Research), following the provided instructions ...
-
bioRxiv - Microbiology 2023Quote: ... Total RNA was isolated from cells using the Direct-zol RNA MiniPrep Kit (Zymo #R2053), following manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: RNA was isolated from total-cell lysates using the Quick-RNATM MiniPrep Kit (Zymo Research) with on-column DNAse treatments ...
-
bioRxiv - Genomics 2024Quote: ... total RNA was isolated from cell lysates using the Quick-RNATM MiniPrep Kit (Zymo Research), RNA quality was assessed based on RIN ...
-
bioRxiv - Genomics 2024Quote: ... total RNA was isolated from cell lysates using the Quick-RNATM MiniPrep Kit (Zymo Research). RNA quality was assessed based on RIN ...
-
bioRxiv - Molecular Biology 2023Quote: ... genomic DNA was harvested from cells using a Quick-DNA 96 Plus Kit (Zymo Research). The DNA concentration was measured using a Qubit 1X dsDNA BR assay kit (ThermoFisher) ...
-
bioRxiv - Neuroscience 2024Quote: ... microglia and other brain cells were extracted using the quick-RNA miniprep kit (Zymo Research) according to manufacturer’s instructions ...
-
bioRxiv - Genomics 2024Quote: ... RNA was extracted from the cell samples using the Quick-RNA Microprep Kit (Zymo, R1050) according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... Total RNA was extracted from cells using Direct-zol RNA Miniprep kit (Zymo Research, R2052). mRNA was purified from total RNA using poly-T oligo-attached magnetic beads and first strand cDNA was synthesized using random hexamer primers ...
-
bioRxiv - Cancer Biology 2024Quote: Total RNA from cells was isolated using Direct-zol RNA miniprep kits (Zymo Research, #R2051). RNA concentration was measured on a NanoDrop OneC (ThermoFisher ...
-
bioRxiv - Physiology 2022Quote: ... DNA was extracted from packed red blood cells (PRBCs) and frozen tissue samples (liver, gonad) using a commercially available DNA extraction kit (Zymo quick-DNA miniprep plus kit) as described previously ...
-
bioRxiv - Developmental Biology 2021Quote: ... 2i mESCs and differentiating cells by first extracting RNA using a Quick-RNA Miniprep Kit (Zymo) with DNase I treatment according to the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... DNA was extracted from blood or cell lines using the Quick-DNA Miniprep kit (Zymo Research), following the manufacturer’s protocol ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Genomic DNA was extracted from sorted cells using the Genomic DNA Clean & Concentrator kit (Zymo Research). PCR fragments were amplified using KAPA HiFi HotStart DNA Polymerase with 2X Master Mix (Roche) ...
-
Histone deacetylase inhibitors butyrate and bufexamac inhibit de novo HIV-1 infection in CD4 T-cellsbioRxiv - Microbiology 2020Quote: RNA was isolated from trizol lysates of cells using Direct-zol RNA Miniprep Kit (Zymo Research) following manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2019Quote: ... Total RNA was extracted from transfected cells and media with Direct-zol RNA kit (Zymo Research), and DNase I in-column digestion was conducted to remove plasmids ...
-
bioRxiv - Neuroscience 2019Quote: Total RNA was extracted from cell lysates using Direct-zol RNA Mini Prep kit (Zymo Research) in combination with peqGOLD TriFast (PeqLab Biotechnologie ...
-
bioRxiv - Cancer Biology 2019Quote: Total RNA was isolated from cells using the Direct-zol RNA miniprep kit (R2060, Zymo Research), with subsequent quantification using Nanodrop (Thermo Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2019Quote: ... genomic DNA (gDNA) was isolated from cells using Quick-DNA Miniprep Kit (11-317AC, Zymo Research). 1.5-4.5 µg of gDNA from each cell line was digested with RsaI and HinfI ...
-
bioRxiv - Cancer Biology 2019Quote: Genomic DNA (gDNA) was isolated from cells using Quick-DNA Miniprep Kit (11-317AC, Zymo Research). 20 μL PCR reactions were performed using 50 ng gDNA and Phusion High-Fidelity DNA Polymerase (F-530 ...
-
bioRxiv - Developmental Biology 2019Quote: DNA was extracted from single cell colonies using the ZR Duet DNA/RNA Miniprep Kit (Zymo). A 708 bp PCR product around the editing site of Satb2-272 was amplified using primers Satb2-seq-F ACTGGCCTGATCGTCTATCA and Satb2-seq-R GCCAGATCCTAGGTCTCTGT ...
-
bioRxiv - Microbiology 2021Quote: ... RNA was extract from Jurat cells using the Direct-zol RNA MiniPrep Plus kit (Zymo Research) and cDNA was prepared ...
-
bioRxiv - Cell Biology 2020Quote: RNA from cells isolated by FACS was extracted using a Trizol-based kit (Zymo Research, R2061) and reverse transcribed using SuperScriptIII (Invitrogen ...
-
bioRxiv - Genetics 2022Quote: Total RNA was extracted from frozen cell pellets using the ZR Fungal/Bacterial miniprep kit (Zymo), according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2022Quote: Total RNA was extracted from cells or organoids using the Quick-RNA MicroPrep kit (Zymo Research). RNA was subjected to quantitative real-time PCR in accordance with the protocol provided by one-step SYBR green RT-PCR Kit (Cwbio) ...
-
bioRxiv - Biochemistry 2022Quote: ... DNA from pre-sort control and sorted cells was extracted with Microprep DNA kits (Zymo Research) and triple-eluted with water ...
-
bioRxiv - Genomics 2022Quote: ... Genomic DNAs from CRISPR edited cells were extracted using Quick-DNA Microprep kit (Zymo Research, D3020). PCR primers were designed to amplify ~1000 bp amplicons from 100-200bp upstream of targeted deletions to 800-900bp downstream of target deletions ...
-
bioRxiv - Bioengineering 2021Quote: RNA was extracted from cells using a Direct-zol RNA MiniPrep Plus Kit (Zymo Research R2071). A Maxima First Strand cDNA Synthesis kit (Thermo Fisher K1641 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: Total RNA from T84 cells was isolated using Direct-zol RNA MiniPrep kits (Zymo, Irvine, California). RNA was extracted initially using TRIzol (Invitrogen ...
-
bioRxiv - Microbiology 2019Quote: ... RNA was extracted from 1−3 × 106 cells using the Quick-RNA Miniprep Kit (Zymo Research) as per manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: ... RNA was purified from bacterial cells using the Quick-RNA™ Miniprep Plus Kit (Zymo Research). Duplicate samples were prepared from independent biological replicates for each condition/strain ...
-
bioRxiv - Systems Biology 2021Quote: ... RNA extraction of the isolated cells was performed with a Quick-RNA MiniPrep Kit by Zymo according to manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2021Quote: RNA was extracted from HEK293 and CDK9as cells using a Quick-RNA Miniprep kit (Zymo Research) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... cells were lysed in Trizol (Thermo) followed by RNA purification with Direct-Zol Micro kit (Zymo). 5’ RACE products were generated with Template Switching RT Enzyme Mix (New England Biolabs ...
-
bioRxiv - Genetics 2019Quote: DNA was extracted from 35-50uL of packed red blood cells using Quick DNA Kit (Zymo). Libraries were prepared with ¼ reaction volumes of the KAPA HyperPlus DNA Library Kit and 20-50ng of extracted DNA according to manufacturer directions with slight modifications ...
-
bioRxiv - Immunology 2021Quote: ... plasmid DNA was transformed into yeast cells using frozen-EZ Yeast Transformation II kit (Zymo T2001). Briefly ...
-
bioRxiv - Bioengineering 2022Quote: ... DNA was extracted from the cell pellets using the ZymoBIOMICS DNA Miniprep kit (Zymo Research, Germany) with cell disruption within 20 min ...
-
bioRxiv - Cancer Biology 2022Quote: Genomic DNA was isolated from cells using the Zymo Research Quick-DNA Miniprep kit (Zymo Research). Adherent cells were washed once with 1X PBS and then lysed by adding ∼1 mL Genomic Lysis Buffer with 0.5% β-mercaptoethanol ...