Labshake search
Citations for Zymo Research :
51 - 100 of 208 citations for Prestained SDS PAGE Standards Single Color since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... 2 mock community samples (Zymo Research DNA standard I D6305), 2 negative DNA extraction samples ...
-
bioRxiv - Microbiology 2023Quote: ... The ZymoBIOMICS microbial community DNA standard (Zymo Research, Irvine, CA) was used as a positive control mock community ...
-
bioRxiv - Genomics 2023Quote: 100ng of ZymoBIOMICS Microbial Community DNA Standard (Zymo Research D6305) was used as template for 2-cycle PCR (Phusion polymerase - ThermoFisher ...
-
bioRxiv - Microbiology 2023Quote: ... The ZymoBIOMICS™ Microbial Community DNA Standard (ref. D6306, Zymo) was amplified and sequenced in the same manner as all other experimental samples.
-
bioRxiv - Immunology 2023Quote: ... The ZymoBIOMICS Microbial Community DNA Standard (Zymo Research, Irvine, CA) was used as a positive control for each targeted library preparation ...
-
bioRxiv - Microbiology 2024Quote: ... DNA from the ZymoBIOMICS™ Microbial Community Standard (Zymo Research) was processed in parallel as a positive control (Supplementary Table S2) ...
-
bioRxiv - Synthetic Biology 2020Quote: ... purified with a ZR small-RNA PAGE Recovery Kit (Zymo Research), eluted in 30 μl TE ...
-
bioRxiv - Microbiology 2022Quote: ... two samples of ZymoBIOMICS Microbial Community DNA Standard (Zymo Research D6305) were added as mock community positive sequencing controls ...
-
bioRxiv - Genomics 2021Quote: ... was used to generate DNA methylation standards: fully methylated (ZYMO-FM), 10% and 5% methylated (DNAm-10pct and DNAm-5pct ...
-
bioRxiv - Molecular Biology 2021Quote: DNA was extracted from 75□Jμl ZymoBIOMICS Microbial Community Standard (Zymo Research Corporation ...
-
bioRxiv - Microbiology 2023Quote: The ZymoBIOMICS® Microbial Community DNA Standard (Zymo Research, Irvine, CA) was used as a positive control for each targeted library preparation ...
-
bioRxiv - Microbiology 2024Quote: ... and ZymoBiomics Microbial Community Standard (Zymo Research, Irvine, CA, United States) were first amplified using 1× Phusion Hot Start II High-Fidelity PCR Master Mix (Thermo Scientific) ...
-
bioRxiv - Microbiology 2024Quote: ... The ZymoBIOMICS Microbial Community DNA Standard (Zymo Research, Irvine, CA, USA), pure culture SBW25 DNA ...
-
Atypical epigenetic and small RNA control of transposons in clonally reproducing Spirodela polyrhizabioRxiv - Plant Biology 2024Quote: ... and purified using ZR small-RNA PAGE Recovery Kit (Zymo Research, # R1070). The elution was then ligated to 5′ barcoded RNA adapters using T4 RNA ligase 1 (New England Biolabs ...
-
bioRxiv - Genomics 2021Quote: ... or single-nuclei (in 96-well PCR plates provided in the Zymo EZ-96 DNA Methylation-Direct™ Kit loaded with 4µL Proteinase K digestion buffer (1µL M-Digestion Buffer ...
-
bioRxiv - Molecular Biology 2020Quote: ... Universally methylated mouse DNA standard (cat. no. D5012, Zymo Research, Irvine, CA) and genomic DNA extracted from normal spleen was used as positive and negative controls ...
-
bioRxiv - Microbiology 2022Quote: ... the V4 region of the ZymoBIOMICS Microbial Community DNA standard (Zymo Research) was also sequenced ...
-
bioRxiv - Microbiology 2023Quote: ... We used ZymoBIOMICS whole organism and DNA microbial community standards (Zymo Research) as well as sterile-filtered PBS to create pairs of positive and negative controls appropriate for each step of the sample collection and isolation procedure ...
-
bioRxiv - Microbiology 2021Quote: ... RNA was recovered using the ZR small-RNA PAGE recovery Kit (Zymo Research). After dephosphorylation of the 3′ ends of the recovered RNA using T4 polynucleotide kinase (T4 PNK ...
-
bioRxiv - Genomics 2021Quote: ... RNA was recovered using the ZR small-RNA PAGE Recovery Kit (Zymo Research) following the manufacturer’s protocol ...
-
bioRxiv - Genomics 2023Quote: ... and single colonies miniprepped and used for transfection(Zymo Research, Cat. No. D4208T).
-
bioRxiv - Molecular Biology 2019Quote: ... The RNA standards were purified using RNA Clean and Concentrator kit (Zymo Research). The identity of the standards was verified by intact mass spectrometry ...
-
bioRxiv - Microbiology 2021Quote: ... as well as the ZymoBIOMICS® Microbial Community Standard (Zymo Research, Irvine, CA) as a positive control ...
-
bioRxiv - Microbiology 2020Quote: The mock microbial community (Zymobiomics Microbial Community Standard; D6300) was obtained from Zymo Research (Irvine ...
-
bioRxiv - Microbiology 2022Quote: ... a commercially available mock microbial community standard was used (ZymoBIOMICS™, Zymo Research). The mock community was extracted using 75 µl per prep as recommended by the manufacturer following the same protocol as all other samples.
-
bioRxiv - Pathology 2023Quote: ... Calculations of alpha and beta diversity were done by standard methodology by Zymo Research.
-
bioRxiv - Cancer Biology 2022Quote: ... DNA was further digested into single nucleosides using DNA Degradase Plus (Zymo Research, E2021).
-
bioRxiv - Microbiology 2020Quote: ... all 5 agar plates were scraped into a single pool and midiprepped (Zymo Research). All conjugations were performed using the diaminopimelic acid (DAP ...
-
bioRxiv - Systems Biology 2023Quote: ... The single-stranded DNA probe was purified using a spin column (Zymo Research, D7010) after RNA digestion with a cocktail of RNase H and RNase A ...
-
bioRxiv - Genomics 2023Quote: ... DNA purified from single cells was treated with the EZ Methylation Direct Kit (Zymo) for bisulfite-conversion following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... a sequencing mock community (ZymoBIOMICS™ Microbial Community Standard, Zymo Research, Irvine, CA, USA) was included in the sequencing project (Fig ...
-
bioRxiv - Microbiology 2021Quote: ... Two positive sequencing controls (ZymoBiomics Microbial Community DNA Standards; Zymo Research, Irvine, California, USA) and two negative sequencing controls (sterile water ...
-
bioRxiv - Microbiology 2020Quote: ... The V4 region of the mock community (ZymoBIOMICS Microbial Community DNA Standard, Zymo Research) was also sequenced to supervise sequencing error ...
-
bioRxiv - Molecular Biology 2020Quote: The ZymoBIOMICS Microbial Community DNA Standard (D6306, lot no. ZRC190811) was obtained from Zymo Research (Irvine ...
-
bioRxiv - Microbiology 2023Quote: ... 1) Amplification of a ZymoBIOMICS Microbial Community DNA Standard (Zymo Research, Irvine, CA U.S.A.) and 2 ...
-
bioRxiv - Microbiology 2023Quote: ... The ZymoBIOMICS Gut Microbiome Standard (cat. no: D6331, lot no: ZRC194753; Zymo Research, USA) is a cell standard comprising 18 bacterial strains (14 species) ...
-
bioRxiv - Developmental Biology 2021Quote: ... Resultant single-stranded oligos were purified by using Zymo DNA concentration kit (Zymo Research, D4030) modified for short-length DNA cleaning ...
-
bioRxiv - Developmental Biology 2023Quote: ... The cDNAs of every single cell were purified using the DNA Clean & Concentrator Kit (Zymo) and loaded and run on 2% agarose gels ...
-
bioRxiv - Biochemistry 2023Quote: ... and 10% SDS) and 1 µl Proteinase K (20 mg/ml; Zymo Research) were added to stop the DNA digest and start the protein digest to free the ssDNA from the AAV particles ...
-
bioRxiv - Synthetic Biology 2024Quote: ... and 10 % SDS) and 1 μl Proteinase K (20 mg/ml; Zymo Research) were added inhibiting the Benzonase and digesting proteins including the AAV capsid to free the ssDNA ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The gel slice was then purified using a ZR small-RNA PAGE Recovery kit (Zymo Research) according to the manufacturer’s instructions.
-
bioRxiv - Genomics 2020Quote: ... we performed a standard genomic DNA extraction using the Quick-DNA miniprep kit (Zymo Research). Again ...
-
bioRxiv - Microbiology 2019Quote: The “Zymo” mock community is the ZymoBIOMICS™ Microbial Community DNA Standard available from Zymo Research (Irvine ...
-
bioRxiv - Genomics 2022Quote: Input DNA from the ZymoBIOMICS Microbial Community DNA Standard II (Log Distribution D6311, Zymo Research) was prepared using SQK-LSK110 (ONT ...
-
bioRxiv - Microbiology 2022Quote: ... A 75 μl aliquot of the ZymoBIOMICS Microbial Community Standard (Zymo Research, Irvine, CA, U.S.A) and 75 μl aliquot of an in-house Community Standard (Colovas et al ...
-
bioRxiv - Cancer Biology 2021Quote: ... in addition to the ZymoBIOMICS™ Microbial Community Standard or MOCK (Zymo Research, Irvine, California) used as a positive control for sequencing ...
-
bioRxiv - Genomics 2021Quote: DNA was extracted from the ZymoBIOMICS Microbial Community Standard cells (Zymo Research, Irvine, CA, USA) using the CD1 lysis buffer and beating beads from a Qiagen PowerSoil Pro Kit (Qiagen ...
-
bioRxiv - Microbiology 2023Quote: ... The ZymoBIOMICS Microbial Community DNA Standard (cat. no.: D6306, lot no: 213089; Zymo Research, USA) is a DNA standard consisting of eight evenly distributed bacteria (3 gram-negative and 5 gram-positive ...
-
bioRxiv - Developmental Biology 2019Quote: DNA was extracted from single cell colonies using the ZR Duet DNA/RNA Miniprep Kit (Zymo). A 708 bp PCR product around the editing site of Satb2-272 was amplified using primers Satb2-seq-F ACTGGCCTGATCGTCTATCA and Satb2-seq-R GCCAGATCCTAGGTCTCTGT ...
-
bioRxiv - Molecular Biology 2019Quote: ... 0.5% SDS) after which DNA was extracted using a Quick-DNA Miniprep kit (Zymo). Viral DNA fold induction was quantified by qPCR using iTaq Universal SYBR Green Supermix (BioRad ...