Labshake search
Citations for Zymo Research :
5101 - 5150 of 9639 citations since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: For human OE and OB RNA was extracted from 10mg of tissue per sample using Direct-zol RNA kit from Zymo Research (Catalog #R2052) ...
-
bioRxiv - Microbiology 2022Quote: ... all samples’ RNA was treated with DNAse 1 (Zymo Research, Catalog # E1010). Post-DNAse digested samples were then put into the NEBNext rRNA depletion v2 (Human/Mouse/Rat) ...
-
Comprehensive fitness landscape of SARS-CoV-2 Mpro reveals insights into viral resistance mechanismsbioRxiv - Molecular Biology 2022Quote: ... PCR products were purified two times over silica columns (Zymo Research) and quantified using the KAPA SYBR FAST qPCR Master Mix (Kapa Biosystems ...
-
bioRxiv - Microbiology 2022Quote: ... The cells and medium were then collected and subjected to RNA extraction using the Direct-zol RNA MiniPrep kit (Zymo Research) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... PCR purification of barcode amplicons with the DNA Clean and Concentrator kit (Zymo Research), and Illumina HiSeq single-end sequencing at LBNL ...
-
bioRxiv - Molecular Biology 2022Quote: ... Digest of the vector (1 h, 37 C) was purified from agarose gel (Zymo Research). We ligated both with an insert:vector ratio of 1:4 using Ligase (Thermo Scientific ...
-
bioRxiv - Molecular Biology 2022Quote: ... The ligation mix was purified (Zymo Research) and 2 μL of the purified reaction mix was used to transform into 50 μL of chemically competent E ...
-
bioRxiv - Genomics 2022Quote: Whole blood genomic DNA (500ng) was treated with sodium bisulfite using the EZ-96 DNA Methylation Kit (Zymo Research) and DNA methylation was assessed using Illumina Infinium MethylationEPIC BeadChip technology (Illumina) ...
-
bioRxiv - Microbiology 2022Quote: ... a 500 μL genomic lysis buffer (Zymo Research Corporation) and 500 μL of phenol:chloroform:isoamyl alcohol (25:24:1 ...
-
bioRxiv - Molecular Biology 2022Quote: ... and processed using Direct-zol (Zymo), including an on-column DNase digest ...
-
bioRxiv - Microbiology 2022Quote: ... RNA was isolated using the Direct-zol RNA Miniprep kit (Zymo, USA) following the manufacturer’s bead beating and DNase I treatment protocol ...
-
Deconstructing the role of iron and heme in the structure of healthy human gut microbial communitiesbioRxiv - Microbiology 2022Quote: ... Sample collection consisted of ∼50 mg of stool being resuspended in 500 μL of DNA/RNA shield (Zymo Research, R1100) and ∼5 g being placed in empty sterile plastic tubes ...
-
bioRxiv - Molecular Biology 2022Quote: RNA was purified from the samples using the Direct-zol kit (Zymo Research). Reverse transcription was performed according to manufacturer instructions using the Superscript IV kit (ThermoFisher ...
-
bioRxiv - Molecular Biology 2022Quote: ... and purified with Direct-zol RNA kits (Zymo), following the manufacturers’ protocols ...
-
bioRxiv - Molecular Biology 2022Quote: ... and purified with Direct-zol RNA kits (Zymo). Uninfected cells were seeded and treated for RNA purification in parallel to serve as controls ...
-
bioRxiv - Cancer Biology 2022Quote: Chromatin immunoprecipitation and qPCR was performed using the Zymo-Spin ChIP kit (Zymo, D5209) as previously described (24) ...
-
bioRxiv - Biochemistry 2022Quote: ... Total RNA was isolated by Zymo Research Direct-zol RNA MiniPrep Kit ...
-
bioRxiv - Genomics 2022Quote: ... DNA was purified with Zymo ChIP clean and concentrator kit (Zymo research) according to manufacturer’s instructions ...
-
bioRxiv - Genomics 2022Quote: ... The remaining PCR reaction was run with the determined cycle number with the same cycler conditions as before and DNA was purified with Zymo ChIP clean and concentrator kit (Zymo research) according to manufacturer’s instructions ...
-
bioRxiv - Genomics 2022Quote: RNA from human RPTECs was extracted with the TRIZOL and Direct-zol MicroPrep Plus Kit (Zymo) following manufacturer’s instructions ...
-
bioRxiv - Genomics 2022Quote: Total RNA was isolated from LV apical core tissue and from beating human iPS cell derived cardiomyocytes using Quick-RNA Miniprep Plus (Zymo Research, Irvine, CA, USA). The qRT-PCR was performed using SYBR mix (Thermofisher ...
-
bioRxiv - Genomics 2022Quote: ... bisulfite conversion was performed using the EZ DNA Methylation-Direct Kit (Zymo Research, D5020) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2022Quote: DNA was obtained from at least 107 yeast per round of selection using a Zymoprep Yeast Plasmid Miniprep II kit (Zymo Research). Primers were designed to amplify the Aga2 leader peptide through to the beginning of the β2M sequence ...
-
bioRxiv - Immunology 2022Quote: ... isolated RNA (Zymo Research R1052), prepared libraries (Lexogen QuantSeq 3’ mRNA-Seq Library Prep Kit (FWD ...
-
bioRxiv - Immunology 2022Quote: ... or Quick-RNA Microprep Kit (Zymo Research), and RNA concentration was measured using NanoDrop (Thermo Scientific) ...
-
bioRxiv - Immunology 2022Quote: ... cells were lysed using RNA Lysis Buffer (Zymo Research, R1060-1-50), and RNA was isolated according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2022Quote: ... or Zymoclean gel DNA recovery kit (Zymo Research - CA, USA). Sanger sequencing was conducted by Eton Bioscience Inc ...
-
bioRxiv - Microbiology 2022Quote: ... Reagent blanks were included as negative controls and cells from a microbial community of known composition were included as positive controls (ZymoBiomics Microbial Community Standards; Zymo Research, Irvine, CA). The V4 region of the 16S rRNA gene was amplified from approximately 5 ng of extracted DNA in 25μl reactions using Q5 HS High-Fidelity polymerase (New England BioLabs ...
-
bioRxiv - Microbiology 2022Quote: ... insect legs were mechanically crushed and resuspended in 50 μl of sterile water and the genomic DNA (gDNA) was extracted using a Quick-DNA Universal kit (Zymo research, USA). 2 μl of the gDNA were added to a GoTaq® Green Master Mix (Promega ...
-
bioRxiv - Microbiology 2022Quote: ... and RNA extracted using the DirectZol (Zymo) kit using manufacturer’s instructions and on-column DNase treatment ...
-
bioRxiv - Microbiology 2022Quote: ... Total DNA was extracted from fecal samples using Quick-DNA™ Fecal/Soil Microbe Miniprep (Zymo Research; Irvine, CA) and DNA concentrations were quantified with a nanodrop ...
-
bioRxiv - Microbiology 2022Quote: ... the RNA was purified using RNA Clean and ConcentratorTM-5 (Zymo). 10µg RNA was denatured at 95°C for 1 min ...
-
bioRxiv - Microbiology 2022Quote: ... The DMS-modified RNA was purified using RNA Clean and ConcentratorTM-5 (Zymo) and eluted in 10µl water.
-
bioRxiv - Microbiology 2022Quote: Plasmids encoding the wildtype and ompK36 mutants were isolated using miniprep (Zymo) and amplified by PCR using a forward primer containing the T7 promoter sequence (TAATACGACTCACTATAGGAAAAGGCATATAACAAACAGAGGG ...
-
bioRxiv - Microbiology 2022Quote: ... The cDNA was purified in 10µl water using the Oligo Clean and ConcentratorTM kit (Zymo). Next ...
-
bioRxiv - Genomics 2022Quote: ... The reaction is incubated in the thermocycler at 50 degrees for 30 minutes and 2μL of assembled reactions were transformed into 20 μL of competent Stbl3 generated by Mix and Go! competency kit (Zymo) and plated on agar plates supplemented with appropriate antibiotics ...
-
bioRxiv - Microbiology 2022Quote: ... These crude extracts were subsequently purified by passage through a OneStep PCR Inhibitor Removal column (Zymo, D6030) and purity was assessed by UV-spectra ...
-
bioRxiv - Microbiology 2022Quote: ... Viral RNA was extracted from infected cell supernatant (Zymo, cat. 11-355), eluted in nuclease-free water ...
-
bioRxiv - Microbiology 2022Quote: ... we applied the same procedures to a positive control (eight species Zymo mock community, Zymo Research, USA) and six negative controls (two for each DNA extraction kits ...
-
bioRxiv - Genetics 2022Quote: ... coli using the Zymoprep Yeast Plasmid Miniprep Kit (Zymo Research). Competent cells were prepared using the Inoue method [17].
-
bioRxiv - Genomics 2022Quote: ... DNA was bisulfite converted using a commercially available kit (Zymo Research, Orange, CA). Illumina Infinium Human Methylation 450K Bead Chip and EPIC Bead Chip were used for genome-wide profiling of DNA methylation.24 The EPIC chip measures over 850 000 methylation sites ...
-
bioRxiv - Genomics 2022Quote: ... and 300 mM NaCl) and purified using DNA Clean and Concentrator-5 Kit (Zymo Research: D4060).
-
bioRxiv - Genetics 2022Quote: ... column-purified (Zymo DNA Clean and Concentrator), eluted in 15 µL water ...
-
bioRxiv - Genetics 2022Quote: ... cDNA was then cleaned up on silica columns (Zymo DNA Clean and Concentrator 5) and eluted in 6.5 µL of water ...
-
bioRxiv - Genetics 2022Quote: ... After clean-up (Zymo RNA Clean and Concentrator 5), 500 ng RNA was capped in a 20 µL reaction using Vaccinia capping system (NEB) ...
-
bioRxiv - Genetics 2022Quote: ... cDNA was column-purified (Zymo DNA Clean and Concentrator 5) and eluted in 25.5 µL water.
-
bioRxiv - Genetics 2022Quote: ... DNA and RNA Clean and Concentrator 5 kits from Zymo Research ...
-
bioRxiv - Genetics 2022Quote: ... followed by another round of clean up (Zymo RNA Clean and Concentrator 5). The final sequence of the spike-in mRNA is ...
-
bioRxiv - Genetics 2022Quote: ... RNA was extracted with the Direct-zol RNA Mini-prep kit (Zymo Research) including on-column DNase treatment and transcribed into cDNA with the qScript cDNA Synthesis Kit (Quantabio) ...
-
bioRxiv - Genetics 2022Quote: ... RNA was extracted with the Direct-zol RNA Mini-prep kit (Zymo Research) including on-column DNase treatment ...