Labshake search
Citations for Eppendorf :
351 - 400 of 861 citations for 6 Chloro 3 4 dihydro 4 methyl 3 oxo 2H 1 4 benzoxazine 8 carboxylic Acid d3 Methyl Ester since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... The stationary pre-cultures were then pooled and washed by centrifugation (5 min, 3,220 g and 4 °C) using a 5810 R swing-out centrifuge (Eppendorf, Hamburg, Germany). After centrifugation ...
-
bioRxiv - Developmental Biology 2023Quote: The filled needle is positioned on a micromanipulator (Narishige MMO-4) and connected to a positive pressure pump (Eppendorf FemtoJet 4i). Control embryos were injected with Cas9 protein and Lap2b-GFP mRNA only.
-
bioRxiv - Biophysics 2023Quote: ... Lysate and cell fragments were separated by centrifugation at 4 °C for 20 min at 12,000 rpm (Centrifuge 5418 R, Eppendorf, Hamburg, Germany). Protein concentrations in the supernatant were determined using the Pierce Micro BCA Protein Assay kit (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2023Quote: ... The cell culture supernatant was collected and pre-cleared from cells and larger particles by centrifugation at 400 × g at 4 °C for 10 min (Eppendorf 5810R) and 10,000 × g at 4 °C for 30 min (Eppendorf 5910R) ...
-
bioRxiv - Biochemistry 2023Quote: ... in 5% glucose solution v/v prior to adding 2X solubilization buffer and incubation at 37 °C for 4 hrs under gentle orbital agitation (500 rpm on Eppendorf Thermomixer). The product was then analyzed by SEC as described earlier.
-
bioRxiv - Developmental Biology 2022Quote: ... The filled needle is positioned on a micromanipulator (Narishige MMO-4) and connected to a positive pressure pump (Eppendorf FemtoJet 4i). Embryos are placed in FHM drops covered with mineral oil under Leica TL Led microscope ...
-
bioRxiv - Biophysics 2023Quote: ... Centrifugation was used to fractionate the cell lysate (at 4 °C for 30 min at 4,416 g, Eppendorf, Centrifuge 5804 R) and at 4 °C for 1 hour for ultracentrifugation (70,658 g ...
-
bioRxiv - Cell Biology 2024Quote: ... the resuspended cilia were centrifuged at 16000 × g for 10 minutes at 4°C in a microfuge (Eppendorf, Centrifuge 5415 D), and the supernatant was removed ...
-
bioRxiv - Physiology 2024Quote: ... plasma samples were thawed from storage at -80°C and centrifuged (5,000 x g, 10 minutes, 4 °C; Eppendorf 5427R with rotor FA-45-48-11; Eppendorf, Enfield, CT). Supernatants were transferred to 96-well plates and stored at -80°C until analysis ...
-
bioRxiv - Cancer Biology 2024Quote: ... The embryos were deyolked in ice cold Ringer’s solution using a micropipette tip and spun at 100 g for 2 min in a tabletop centrifuge at 4°C (Eppendorf, 5418R). The supernatant was discarded and the embryo bodies were trypsinized using TrypLE Express (Thermo Scientific ...
-
bioRxiv - Neuroscience 2021Quote: ... EGFP RVS 5’-3’= TGTGGCGGATCTTGAAGTTAG on a Mastercycler Pro (Eppendorf) thermocycler PCR machine ...
-
bioRxiv - Immunology 2022Quote: ... was added to the cells and they were incubated for 30 min at 4 °C and 750 RPM on a thermomixer (Eppendorf, ThermoMixer C). The liquid in the plate was removed using a vacuum manifold ...
-
bioRxiv - Immunology 2022Quote: ... was added to the cells and they were incubated for 45 min at 4 °C and 750 RPM on a thermomixer (Eppendorf, ThermoMixer C). The liquid in the plate was removed using a vacuum manifold ...
-
bioRxiv - Cell Biology 2021Quote: ... Cell lysate was spun down at 13600 rpm for 10 minutes at 4°C on a table-top microcentrifuge (Eppendorf, Hamburg, Germany). 1 μl was used to determine protein concentration using Bradford dye at 595 nm wavelength ...
-
bioRxiv - Cell Biology 2020Quote: ... Cell lysate was spun down at 13600 rpm for 10 min at 4°C on a table-top microcentrifuge (Eppendorf, Hamburg, Germany). 1 μl was used to determine protein concentration using Bradford dye at 595 nm wavelength ...
-
bioRxiv - Immunology 2021Quote: ... The 80 µL aliquot was lyophilised for 4 h at 30 °C with the aid of a vacuum concentrator (Eppendorf Concentrator 5301) attached to a refrigerated condensation trap (Savant) ...
-
bioRxiv - Biophysics 2020Quote: ... 200 ml of M9 minimal media were added to 4 mL of pre-inoculum and the cell growth was monitored using Biophotometer D30 (Eppendorf, Hamburg, Germany) until the growth rate was 0.8 (OD at 600 nm) ...
-
bioRxiv - Microbiology 2022Quote: ... coli S17-1 that contained the shuttle- or suicide-vector construct at 3700 rpm for 10 min at room temperature (Centrifuge 5920 R, rotor S-4×1000, Eppendorf, Hamburg, Germany). We mixed the E ...
-
bioRxiv - Cell Biology 2020Quote: ... and the cells were pelleted by centrifugation at approximately 250 × g for 5 min at 4 °C (Eppendorf 5804 R, Hamburg, Germany). After resuspension ...
-
bioRxiv - Cell Biology 2021Quote: Live-cell microinjection experiments were performed using a FemtoJet® 4i microinjector in conjunction with an InjectMan® 4 micromanipulation device (Eppendorf). All microinjections were performed using pre-pulled Femtotips® injection capillaries (Eppendorf) ...
-
bioRxiv - Microbiology 2024Quote: ... The culture supernatant was collected by centrifugation (6,000 rpm, 10 min, 4°C; R10A2 rotor, Himac CR21F; Eppendorf Himac Technologies, Hitachinaka, Japan). For cultures grown under photoautotrophic conditions ...
-
bioRxiv - Genetics 2024Quote: ... The samples were sonicated on ice for 12 to 15 minutes and then centrifuged for 10 minutes at 13200 rpm and 4 °C (Eppendorf centrifuge 5415R) to remove the cell debris ...
-
bioRxiv - Zoology 2023Quote: ... The homogenates were centrifuged for 10 minutes (860 g at 4 °C) to remove the solid particulates (5810R, Eppendorf centrifuge, Hamburg, Germany) and the supernatant was removed and stored at -80 °C for later analysis [19] ...
-
bioRxiv - Neuroscience 2023Quote: ... freshly laid embryos were aligned against nitrocellulose paper and injected using a quartz capillary needle, three-axis micromanipulator (Narishige, MMO-4) and microinjector (Eppendorf FemtoJet 4X).
-
bioRxiv - Genomics 2023Quote: ... Cells were pelleted by spinning at 800 g for 10 min at 4 °C in a swinging bucket centrifuge (Eppendorf Centrifuge 5810R). The supernatant was gently removed ...
-
bioRxiv - Biophysics 2023Quote: ... This pre-gel solution was kept at 4 °C inside an amber UV-protected 1.5 mL microcentrifuge tube (Eppendorf®, Hauppauge, NY), and degassed for 1 h inside a vacuum chamber to reduce oxygen concentration and prevent early gelation inside the driving syringe while running the experiment ...
-
bioRxiv - Immunology 2023Quote: ... cells were labeled with 50 nM of biotinylated human ACE2 protein (Acro Biosystems, AC2-H82E6) for 30 minutes at 4°C at 700 RPM on a shaker (Eppendorf, ThermoMixer C). The cells were subsequently washed ...
-
bioRxiv - Microbiology 2023Quote: ... We performed fragmentation of 4 µg DNA in a 46-µL elution volume in Covaris G-tubes by centrifuging at 4200–5000 rpm (Eppendorf 5424 centrifuge) for 90 s to achieve fragment sizes of ∼20 kb ...
-
bioRxiv - Microbiology 2024Quote: ... Pre-weighted metal-free 15 mL propylene tubes were used to pellet the cells in a tabletop centrifuge at 4 °C (Eppendorf, Hauppauge, NY). Pellets were washed three times with 10 mL of ice-cold PBS ...
-
bioRxiv - Microbiology 2024Quote: ... The mixture was centrifuged for 30 min at 15000 rpm at 4°C in the centrifuge Eppendorf 5702RH (Eppendorf SE, Hamburg, Germany). The pellet was resuspended in the 1/5 of the in initial volumes in PBS buffer (ThermoFischer Scientific ...
-
bioRxiv - Systems Biology 2024Quote: ... with a mounted tissue section was dried to 37°C for 4 minutes on a thermal incubator (Eppendorf Thermomixer Option C, Germany) followed by in situ fixation in 4% PFA (Sigma Aldrich ...
-
bioRxiv - Developmental Biology 2024Quote: ... To create extrachromosomal arrays constructs were microinjected into distal gonads of young adults using inverted microscope Leica DMi8 equipped with DIC filters and microinjection system InjectMan® 4 and FemtoJet® 4i (Eppendorf). Microinjection mixtures contained 10 ng/μL of the plasmid of interest ...
-
bioRxiv - Plant Biology 2024Quote: ... The supernatant was collected after centrifugation at 4 °C for 5 min at 5000 g and dried using a SpeedVaq (Eppendorf, Montesson, France). Then ...
-
bioRxiv - Bioengineering 2024Quote: ... 500μl of samples previously diluted by 10 in DPBS were deposited in Amicon® filter before centrifugation at 2000g during 15min at 4°C (Centrifuge 5804 R, Eppendorf®). Then ...
-
bioRxiv - Developmental Biology 2024Quote: Chromatin was pre-cleared by centrifugation at 14,000×g for 15min at 4°C and the supernatant was moved to a 1.5mL DNA LoBind® tube (Eppendorf: Hamburg, Germany). From each chromatin sample per phenotype per lineage ...
-
bioRxiv - Cell Biology 2024Quote: ... The sample was placed on ice to incubate for 30 minutes before the demembraned flagella supernatant was removed after centrifugation at 16,000 × g for 10 min at 4°C in a microfuge (Eppendorf, Centrifuge 5415 D). The pellet containing the axoneme was resuspended in 245 μl of Cilia Final Buffer (without trehalose) ...
-
bioRxiv - Immunology 2024Quote: ... stool suspensions of feces (in H2O) were centrifuged at 16000 rpm and 4°C for 5 min using an Eppendorf 5427R centrifuge (Eppendorf; Hamburg, Germany). 100 µL of supernatant were mixed with 400 µL of ice-cold methanol containing recovery standards for evaluation of the quality of cell harvest and correction for variations ...
-
bioRxiv - Immunology 2024Quote: ... Before preparation for LC-MS analysis each sample was centrifuged at 16000 rpm and 4°C for 5 min using an Eppendorf 5427R centrifuge (Eppendorf; Hamburg, Germany). From each supernatant 350 µL were pipetted into two separate LC vials ...
-
bioRxiv - Microbiology 2024Quote: ... by centrifugation at 8,000 rpm for 3 mins (Eppendorf 5417C centrifuge). The supernatant was decanted ...
-
bioRxiv - Microbiology 2021Quote: ... The media was spun down in a centrifuge at 4°C for 10 min at 4400 g (Centrifuge 5920 R, Eppendorf Nordic, Hørsholm, Denmark) and the supernatant collected and stored at -80° for 1H NMR analysis ...
-
bioRxiv - Microbiology 2021Quote: ... Development of ∼60 % cytopathic effect (CPE) led to harvesting and clarification of supernatants (3184 x g, 20 min, 4 °C, in an Eppendorf 5810 R centrifuge). Aliquots were then titred by plaque assay (see below) ...
-
bioRxiv - Microbiology 2021Quote: The rest of the supernatant cell suspension (~19 ml) was centrifuged in a swing-out rotor (Eppendorf A-4-62 Swing Bucket Rotor) at 3200 × g for 10 min to pellet cells ...
-
bioRxiv - Neuroscience 2023Quote: ... blood samples were allowed to clot at room temperature for 30 minutes before undergoing centrifugation at 1500 × g for 10 minutes at 4°C using a refrigerated centrifuge (Eppendorf AG, Hamburg, Germany). The supernatant serum was pipetted into sterile 1.5 mL Eppendorf tubes and stored at -80°C until further analysis.
-
bioRxiv - Physiology 2024Quote: ... Blood was allowed to clot on ice for 20 minutes then was spun down in a cold centrifuge (4°C, Eppendorf microcentrifuge, model 5415R) for 20 minutes at 2000 g ...
-
bioRxiv - Cell Biology 2024Quote: The cilia suspension was thawed on ice and then centrifuged at 16000 g and 4°C for 10 minutes in a microfuge in a refrigerated room (Eppendorf, Centrifuge 5415 D). The pellet was resuspended in 250 μl of ice-cold Cilia Final Buffer (50 mM HEPES at pH 7.4 ...
-
bioRxiv - Molecular Biology 2023Quote: ... The mixture was sonicated 3 times for 1 minute in a waterbath sonicator and incubated in a ThermoMixer (Eppendorf) for 30 minutes at 37°C and 500 rpm ...
-
bioRxiv - Bioengineering 2023Quote: ... MPCs were washed twice for 3 min at 400 RCF at room temperature with PBS supplemented with 1% glucose and 1% pen-strep (Eppendorf 5702R, Hamburg, Germany). Biotinylation of the cell surface was performed by adding 1 mM Sulfo-NHS-LC-Biotin (Thermo Fisher ...
-
bioRxiv - Developmental Biology 2021Quote: ... diluted 1:250 in 500ul PBSFBT either ON or for 2h at 32°C in a heating block (ThermoMixer C, Eppendorf) with integrated shaking (350rpm) ...
-
bioRxiv - Genomics 2020Quote: The ST slide with the tissue section was warmed to 37°C for 4 minutes on a thermal incubator (Eppendorf Thermomixer Option C, Germany) and in situ fixed and washed as described above ...
-
bioRxiv - Microbiology 2020Quote: ... The presumptive cultures were grown in TSBYE broth for 24 h at 30°C and centrifuged at 4°C (Eppendorf, 5810R, Auckland, New Zealand) at 3,220 × g for 10 min ...