Labshake search
Citations for Eppendorf :
351 - 400 of 904 citations for 2 Bromo 1 5 bromofuran 2 yl ethanone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... 5 % CO2 using microloaders (Eppendorf). Slices were placed into the incubation chambers one at a time (minimum volume 1.5 ml to cover raised grid) ...
-
bioRxiv - Microbiology 2021Quote: ... 1 μl of the lipid-containing lower organic phase was spotted on a MALDI target plate (Prespotted AnchorChip 96 Set for Proteomics II; Bruker Daltonics/Eppendorf; washed peptide-free with 2-propanol) pre-spotted with 1 µl of 9-aminoacridine (10 mg/ml dissolved in acetone:water 9:1 (v/v) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The fractions with highest concentrations (200–400 μg mL−1) were stored as 5–10 μL aliquots in Protein LoBind tubes (Eppendorf) at –80 °C.
-
bioRxiv - Systems Biology 2023Quote: ... and incubated on ice for 1 min before pelleting with a swinging-bucket centrifuge (500 x g, 5 min, 4°C; 5920R, Eppendorf). Supernatant was gently removed and ∼50 µl were left behind to increase nuclei recovery ...
-
bioRxiv - Neuroscience 2023Quote: Neurons remained in medium and were incubated in ∼1% O2 (5% CO2, 37°C) for 360 min in a triple-gas incubator (Eppendorf) and then returned to normoxic conditions (21% O2 ...
-
bioRxiv - Genomics 2024Quote: ... and incubated on ice for 1 minute before pelleting with a swinging-bucket centrifuge (500 x g, 5 min, 4°C; 5920R, Eppendorf). The supernatant was gently removed and ∼50 µl were left behind to increase nuclei recovery ...
-
bioRxiv - Cancer Biology 2024Quote: ... EVs-beads conjugates were then incubated with 15 uL EVs detection reagent (5 uL of CD9, CD63, CD81 detection reagents) for 1 hour at room temperature in Thermomixer orbital shaker (Eppendorf). Samples were washed with 500 uL MACSPlex buffer and centrifuged at 3000xg for 5 minutes at room temperature ...
-
bioRxiv - Cell Biology 2023Quote: ... transferred in 5 ml tubes (Eppendorf) and 480 μl Triton-X-100 (2% [vol/vol] final concentration ...
-
bioRxiv - Bioengineering 2021Quote: ... CsupADH_17286 and HzeaADH7 were introduced into Agrobacterium tumefaciens GV3101 strain (MP90RK) by electroporation (1700 V mm-1, 5 ms, Eppendorf 2510). A viral silencing suppressor protein P19 was introduced into GV3101 strain as well in order to inhibit the host cells’ transgene silencing apparatus and extend transgene expression over a longer period of time with a higher degree of expression (Canto et al ...
-
bioRxiv - Cell Biology 2023Quote: ... or at 37°C/5% CO2/1% O2 in a nitrogen-controlled hypoxic incubator (New Brunswick Galaxy 170R, Eppendorf, Hamburg, Germany). Prior to media changes ...
-
bioRxiv - Immunology 2020Quote: Using 5 mL lo-bind tubes (Eppendorf), 960 μL of ice-cold methanol was added to ~1 mL of protein supernatant and vortexed briefly before subsequent addition of 160 μL of ice-cold chloroform and thorough mixing ...
-
bioRxiv - Microbiology 2022Quote: ... Bacterial mixtures were diluted 1:1000 into LB with or without 1% DMSO (v/v) and incubated standing at 37°C in 5% CO2 at atmospheric oxygen (normoxic; Eppendorf CellXpert incubator), 1% oxygen (hypoxic ...
-
bioRxiv - Bioengineering 2022Quote: ... Subsequent washes were performed at a volume of 5 mL in 5 mL Eppendorf tubes (Cat. No. 0030122321, Eppendorf) and pelleted with a compatible microcentrifuge (MC-24™ Touch ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... were diluted with sterile 1x PBS to 10 µg/mL (according to the manufacturer’s recommendation) in the volume of 5 mL in 5-mL Protein LoBind tubes (Eppendorf). For chip assays ...
-
bioRxiv - Genomics 2021Quote: ... Nuclei were rotated at 4 °C for 5 minutes before being pelleted again with a swinging bucket centrifuge (500 x g, 5 min, 4°C; 5920R, Eppendorf). After centrifugation ...
-
bioRxiv - Genomics 2021Quote: ... nuclei were rotated at 4 °C for 5 minutes before being pelleted again with a swinging bucket centrifuge (500 x g, 5 min, 4°C; 5920R, Eppendorf). After centrifugation ...
-
bioRxiv - Microbiology 2023Quote: ... vortexed for 5 min and then centrifuged (Eppendorf Centrifuge model 5810 R ...
-
bioRxiv - Microbiology 2023Quote: ... centrifuging for 5 min at 7,500 rcf (Eppendorf, tabletop centrifuge MiniSpin plus with rotor F-45-12-11) ...
-
bioRxiv - Developmental Biology 2024Quote: ... The cells were washed with cold staining buffer (1× PBS, 0.2% BSA and 5 mM glucose) and spun down at 150 × g with low brake (Eppendorf Centrifuge 5810 R, Hamburg, Germany). The cell number was counted using a hemocytometer ...
-
bioRxiv - Cell Biology 2020Quote: ... 5000 rpm for 5 min in 5415D centrifuge (Eppendorf) to remove aggregates.
-
bioRxiv - Neuroscience 2024Quote: ... Samples were pooled in 5 mL LoBind tubes (Eppendorf) in 1 mL chilled lysis buffer (10 mM Tris-HCl ...
-
bioRxiv - Bioengineering 2024Quote: ... centrifuged at 1200 RPM for 5 minutes (Eppendorf 5180) and stained for cell viability using Fixable Live/Dead Blue for 30 min at 4°C ...
-
bioRxiv - Genomics 2022Quote: ... typically a 5 mL Lo-bind tube (0030122348, Eppendorf) or 15 mL falcon tube (229410 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Tissue homogenates were transferred to 5 mL centrifuge tubes (Eppendorf) and supplemented with 20 U benzonase and 10 U avidin prior to incubating with rotation at 4 °C for 20 min and subsequent removal of debris by centrifugation at 16,000 × g for 15 min.
-
bioRxiv - Cancer Biology 2021Quote: ... at 37°C in a humidified 5% CO2 incubator (Eppendorf). Stable cell lines overexpressing Api5 was prepared using lentiviral-mediated transduction ...
-
bioRxiv - Neuroscience 2021Quote: ... EGFP RVS 5’-3’= TGTGGCGGATCTTGAAGTTAG on a Mastercycler Pro (Eppendorf) thermocycler PCR machine ...
-
bioRxiv - Cancer Biology 2021Quote: ... Tissue powder was weighed (5-20mg in precooled Eppendorf tubes), and tissues were extracted by vortexing in 40x volumes precooled acetonitrile-methanol-water (40%/40%/20% v/v/v) ...
-
bioRxiv - Cell Biology 2020Quote: ... for 5 min at room temperature (Eppendorf Centrifuge 5427 R). Columns were washed with 65 µl elution buffer (5% ammonia solution in water) ...
-
bioRxiv - Cell Biology 2023Quote: ... in a 5% CO2 containing humidified incubator (Eppendorf Galaxy 170S) at 37°C.
-
An apical protein, Pcr2, is required for persistent movement by the human parasite Toxoplasma gondiibioRxiv - Cell Biology 2022Quote: ... and centrifuged for 5 min at 2,000rpm (Eppendorf Centrifuge 5415D) to separate the secreted fraction (supernatant ...
-
bioRxiv - Cell Biology 2022Quote: ... in a 37°C humidified incubator with 5% CO2 (Eppendorf).
-
bioRxiv - Immunology 2024Quote: ... samples were microcentrifuged at 12,000g for 5 min (Eppendorf 5415C), supernatant aspirated and discarded ...
-
bioRxiv - Microbiology 2024Quote: ... kidneys and spleens were homogenized in 5 mL tubes (Eppendorf) containing 500uL of 3.2mm stainless steel beads (Next Advance ...
-
bioRxiv - Microbiology 2024Quote: ... and harvested by centrifugation (Eppendorf 5417, 20,817 g, 5 min). The cell pellet was then resuspended with equal volumes (1 ml ...
-
bioRxiv - Biophysics 2024Quote: ... 50 mM NaCl in 5 ml Protein LoBind tubes (Eppendorf). For refolding ...
-
bioRxiv - Biophysics 2024Quote: ... at 90°C for 5 minutes (Thermomixer C, Eppendorf, MA). The samples were loaded onto a 4-20% Mini-PROTEAN precast protein gel (Bio-Rad ...
-
bioRxiv - Neuroscience 2020Quote: We transferred 5 dpf larvae to 1.5 ml centrifuge tubes (Eppendorf). All fish water was aspirated and replaced with 1.0 ml 4% paraformaldehyde (Electron Microscopy Sciences ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... volume was reduced to 5 μL in a Speedvac concentrator (Eppendorf) and sequencing libraries were prepared using the TruSeq Small RNA Library Prep Kit (Illumina) ...
-
bioRxiv - Bioengineering 2021Quote: ... dissected brains were placed in 5 ml tubes (Eppendorf, 0030 119.401) and covered with 4.5 mL of clearing solution ...
-
bioRxiv - Developmental Biology 2024Quote: ... for 5 min at 37 °C under agitation (Eppendorf, ThermoMixer C). Lobes were pipetted to promote dissociation ...
-
bioRxiv - Microbiology 2024Quote: ... The samples were centrifuged at 272g for 5 minutes (Eppendorf 5810R) at 4°C ...
-
bioRxiv - Bioengineering 2023Quote: ... and centrifuged at 8000 rpm for 5 min (Centrifuge 5430, Eppendorf), where the dissociated monomers or oligomers were separated and mainly located in the supernatant ...
-
bioRxiv - Biophysics 2023Quote: ... and applied 1,700 V for about 5 ms (Eppendorf Eporator, 4309000027). We quickly washed the cuvette with 500 μl SOC growth medium twice and cells were allowed to recover at 37 °C for 1 hour in a 50 ml conical tube (Corning ...
-
bioRxiv - Plant Biology 2024Quote: ... The seedlings were first placed in 5 mL tubes (Eppendorf #0030119460) and snap frozen in liquid nitrogen.
-
bioRxiv - Cell Biology 2024Quote: Cell culture maintenance incubator (37 °C, 5% CO2, humidified; Eppendorf CellXpert)
-
bioRxiv - Cell Biology 2022Quote: Samples were incubated on a rotator for 5 min at 4°C and then centrifuged at 500g for 5 min (Eppendorf, 5920R; 4°C, ramp speed of 3/3). Supernatant was removed and pellet was resuspended in sort buffer [1mM EDTA (Invitrogen ...
-
bioRxiv - Biophysics 2021Quote: HEK-293T cells were cultured at 37 °C and 5% CO2 (Eppendorf). Cells were plated in 60 mm dishes and transfected with 1 ug of GFP-TAX4 and 3 ug of PEI-MAX per dish ...
-
bioRxiv - Neuroscience 2020Quote: ... Male heads were incubated for 5 min on a ThermoMixer (Eppendorf 5382000023), and 25 min in a rotating hybridization oven ...
-
bioRxiv - Molecular Biology 2022Quote: ... The beads were then transferred to a 5 mL centrifuge tube (Eppendorf) and filled up completely with TEV buffer ...
-
Proteome Profiling of Cerebrospinal Fluid Reveals Novel Biomarker Candidates for Parkinson’s DiseasebioRxiv - Systems Biology 2021Quote: ... samples were shaken for 5 min at 2,000 rpm (thermomixer C, Eppendorf). Peptide concentrations were measured optically at 280nm (Nanodrop 2000 ...