Labshake search
Citations for Eppendorf :
351 - 400 of 497 citations for 2 Trimethylsilyl Furo 3 2 B Pyridine 6 Carbaldehyde since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2021Quote: ... for 6 h at 37 °C at 800 rpm (shaking incubator, Eppendorf). After RNAse A was removed by centrifugation ...
-
bioRxiv - Genomics 2024Quote: ... 80 µL H2O) for 6 minutes on a shaker (Eppendorf Thermomixer Comfort) at 28°C and 400 rpm ...
-
bioRxiv - Microbiology 2021Quote: ... 1 μl of the lipid-containing lower organic phase was spotted on a MALDI target plate (Prespotted AnchorChip 96 Set for Proteomics II; Bruker Daltonics/Eppendorf; washed peptide-free with 2-propanol) pre-spotted with 1 µl of 9-aminoacridine (10 mg/ml dissolved in acetone:water 9:1 (v/v) ...
-
bioRxiv - Biophysics 2020Quote: ... with three ssDNA overhang strands on a bottom partially complementary to the sequence on the magnetic beads (mag2, Supplementary Table 5) were incubated together for 2 h at 37 °C under gentle shaking (450 rpm, Eppendorf ThermoMixer® C, Eppendorf AG, Germany). Unbound DNA origami was removed by placing the tube on a magnet and discarding the supernatant ...
-
bioRxiv - Systems Biology 2024Quote: 20 mL of culture from each of 3 experimental replicates (n = 3) was collected in Protein LoBind tubes (Eppendorf, Hamburg, Germany) by centrifugation at 1650 xg for 10 min ...
-
bioRxiv - Molecular Biology 2022Quote: ... falciparum 3D7 (68) were cultured in human red blood cells (O+ or B+, Blood bank, Universitätsklinikum Hamburg-Eppendorf). Cultures were maintained at 37°C in an atmosphere of 1% O2 ...
-
bioRxiv - Molecular Biology 2023Quote: ... FLAG-tagged Z-B dimers (to 25 nM in 25 µL) in a 1.5-mL LoBind tube (Eppendorf). Then canonical nucleosomes (from native or recombinant source ...
-
bioRxiv - Developmental Biology 2023Quote: ... Organoids were transferred to a 6 cm ultra-low-attachment dish (Eppendorf, 30701011) containing Tyrode’s solution (Sigma ...
-
bioRxiv - Systems Biology 2020Quote: ... Samples were eluted with 60 μL of buffer B (80% ACN, 0.1% formic acid in H20) and reduced in a Vacufuge plus (Eppendorf) to a final volume of 3 μL ...
-
bioRxiv - Cell Biology 2020Quote: ... or western blot analysis (200 000 cells in 6-well plates (Eppendorf, cat# 0030720113) were left to attach for 48h ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were then seeded in a Matrigel-coated 6-well plate (Eppendorf, cat # 0030720113) to 2.5×106 cells/well with dual SMAD inhibitor media supplemented with Dorsomorphin (1μM ...
-
bioRxiv - Genomics 2024Quote: ... 6-8×105 cells were sorted in a 5mL low binding tube (Eppendorf, 0030122356) pre-coated with 1mL of 1X PBS + 0.04%BSA (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2024Quote: ... 10,000 × g for 40 min using with FA-45-6-30 Rotor (Eppendorf, Germany), 100,000 × g ultracentrifugation for 90 min using Himac CP70NE Ultracentrifuge (Himac ...
-
bioRxiv - Neuroscience 2021Quote: ... EGFP RVS 5’-3’= TGTGGCGGATCTTGAAGTTAG on a Mastercycler Pro (Eppendorf) thermocycler PCR machine ...
-
bioRxiv - Neuroscience 2024Quote: ... regionalized neural organoids (1-3 organoids per one Eppendorf tube) were transferred into a 1.5 mL Eppendorf tube containing 200 μL of the neural medium ...
-
bioRxiv - Cell Biology 2021Quote: ... were mixed and injected into the cytoplasm of fertilized eggs in a droplet of HEPES-CZB medium containing 5ug/ml cytochalasin B (CB) using a FemtoJet microinjector (Eppendorf) with constant flow settings ...
-
bioRxiv - Genomics 2024Quote: ... 3uL of SL-B reagent (BioSkryb Genomics, USA) was deposited in each well of a LoBind twin.tec PCR plate (Eppendorf, Germany) prior to sorting ...
-
bioRxiv - Developmental Biology 2023Quote: ... were mixed in HEPES-CZB medium containing 5 μg/ml cytochalasin B (CB) and injected into the cytoplasm of fertilized eggs using a FemtoJet microinjector (Eppendorf) with constant flow settings ...
-
bioRxiv - Developmental Biology 2024Quote: ... Another 1 ml of Washing buffer B was added and transferred to 1.5 ml Protein lo-bind tubes (Eppendorf, 0030108116) with beads ...
-
bioRxiv - Molecular Biology 2024Quote: ... The peptides were eluted from the C18 with buffer B (0.1% TFA, 40% AcN) before drying with a Vacufuge plus (Eppendorf 022820109). Dried peptides were reconstituted in 0.1% TFA & 0.5% AcN before loading on a timsTOF Pro 2 operated in DIA-PASEF mode coupled to a NanoElute UHPLC system (Bruker Daltonics) ...
-
bioRxiv - Biophysics 2024Quote: ... and eluted by adding 1mL Buffer B to the cartridge and spinning in a swing bucket rotor (Eppendorf 5910 R) at 300rpm for 5 min ...
-
bioRxiv - Biophysics 2024Quote: ... and eluted by adding 1mL Buffer B to the cartridge and spinning in a swing bucket rotor (Eppendorf 5910 R) at 300rpm for 5 min ...
-
bioRxiv - Developmental Biology 2024Quote: ... were mixed in HEPES-CZB medium containing 5 μg/ml cytochalasin B (CB) and injected into the cytoplasm of fertilized eggs using a FemtoJet microinjector (Eppendorf) with constant flow settings ...
-
bioRxiv - Biochemistry 2021Quote: ... cells were seeded into 6-well or 12-well polystyrene coated plates (Eppendorf; EP0030720130, EP0030721012) at a density of 0.3 x 106 cells mL−1 or 0.1 x 106 cells mL−1 ...
-
bioRxiv - Microbiology 2024Quote: ... by centrifugation at 8,000 rpm for 3 mins (Eppendorf 5417C centrifuge). The supernatant was decanted ...
-
bioRxiv - Synthetic Biology 2022Quote: ... and then 6 mL of the culture was collected by centrifugation at 2,500g (5810 R, Eppendorf) for 5 min at room temperature.
-
bioRxiv - Microbiology 2024Quote: An agar plug (6 mm diameter) of the bacterial culture was transferred to a vial (Eppendorf) and extracted with 1 mL of isopropanol ...
-
bioRxiv - Cell Biology 2022Quote: Samples were incubated on a rotator for 5 min at 4°C and then centrifuged at 500g for 5 min (Eppendorf, 5920R; 4°C, ramp speed of 3/3). Supernatant was removed and pellet was resuspended in sort buffer [1mM EDTA (Invitrogen ...
-
bioRxiv - Synthetic Biology 2022Quote: ... a 6 mL portion of each cell culture was collected by centrifugation at 2,500g (5810 R, Eppendorf) for 5 min at 4 °C ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Plates were then centrifuged at 330 rpm for 3 min (Eppendorf, Centrifuge 5810). Plates were then incubated at 37°C for 24 hours ...
-
bioRxiv - Bioengineering 2022Quote: ... Cells were centrifuged 3 minutes at 800-1000 RPM (Eppendorf 5810 tabletop centrifuge) and resuspended ...
-
bioRxiv - Microbiology 2023Quote: ... qPCR analysis was carried out in 96 well plates using Quantstudio 3 (Eppendorf). Amplification was carried out at 95°C for 15 min and 50 cycles at 95°C for 15s ...
-
bioRxiv - Microbiology 2021Quote: ... Three 6-mm leaf discs from three separate leaves were punched directly into an Eppendorf tube (Eppendorf, Germany) containing 500 μl of CSPL buffer (Omega Bio-Tek ...
-
bioRxiv - Biochemistry 2022Quote: ... Wholemeal flour samples were weighed (6 mg) and transferred into a deep well plate (96/1000 μL, Eppendorf). Phosphate buffered saline (600 μL ...
-
bioRxiv - Molecular Biology 2024Quote: A total of 350,000 HEK293-T cells were seeded in each well of 6-well plates (#EP0030720113, Eppendorf). Transfection was performed the day after at 40-50% cell confluence ...
-
High resolution, serial imaging of early mouse and human liver bud morphogenesis in three dimensionsbioRxiv - Developmental Biology 2021Quote: ... Cells were centrifuged 3 minutes at 800-1000 RPM (Eppendorf 5810 table top centrifuge) and resuspended ...
-
bioRxiv - Genomics 2020Quote: ... 3 ml of each bacterial suspension were centrifuged at 6,000 × g (Eppendorf, Westbury, NY) for 2 mins ...
-
bioRxiv - Plant Biology 2020Quote: ... The homogenates were centrifuged at 1,000 g for 3 min (Eppendorf 5430, Hamburg, Germany). The subsequent steps of the RNA extraction were performed on the supernatants according to the manufacturer’s specifications ...
-
bioRxiv - Biochemistry 2022Quote: ... for 3 min and then reduced to dryness in a Vacufuge centrifugal concentrator (Eppendorf).
-
bioRxiv - Cell Biology 2020Quote: ... 1% P/S on a magnetic separator cells were cultured in fibronectin-coated 6-well plates (Eppendorf, Hamburg, Germany) in DMEM/F-12 ...
-
bioRxiv - Synthetic Biology 2020Quote: ... These reactions were incubated for 0-6 h at 30°C with 500 rpm shaking (Eppendorf, Thermo Mixer C). S ...
-
bioRxiv - Microbiology 2020Quote: ... 0.6 mL culture were centrifuged at 13,350 rpm for 6 min in a Benchtop centrifuge (5424 Eppendorf, Hamburg, Germany). The supernatant was filtered through a 0.22-µm polyvinylidene fluoride syringe filter (Carl Roth ...
-
bioRxiv - Neuroscience 2020Quote: The homogenates were pelleted at 400xg for 6 minutes at 4°C in a swing-bucket rotor centrifuge (Eppendorf). The supernatants were removed and 1 ml ice-cold DPBS (pH 7.3-7.4 ...
-
bioRxiv - Bioengineering 2023Quote: ... these samples were centrifuged for 6 min at 16,740 x g at room temperature (5427 R, Eppendorf, Hamburg, Germany), and the supernatant was discarded ...
-
bioRxiv - Neuroscience 2024Quote: Transgenic male and female flies were maintained under a dark condition for 4-6 days after eclosion and then transferred to a plastic tube (1.5 mL, Eppendorf) containing ∼200 µL of fly food ...
-
bioRxiv - Immunology 2021Quote: Xela DS2 (passages 120 – 130) and Xela VS2 (passages 125 – 135) (n = 4 independent trials) were seeded in a 6-well plate (Eppendorf) at a cell density of 625,000 cells/well in 1 mL of Xela complete media and allowed to adhere overnight at 26 °C ...
-
bioRxiv - Microbiology 2021Quote: ... The dialysis block was then incubated at 37°C for 6 hours with constant shaking at 400rpm (Thermomixer comfort, Eppendorf). After 6 hours ...
-
bioRxiv - Microbiology 2021Quote: ... with 100 μl aliquot of the ultra-low gelling temperature agarose gel solution (6% in Mueller Hinton Broth II, cation-adjusted) to 85 °C in a Thermomixer (Eppendorf Thermomixer R Shaker, Eppendorf). Once the temperature was reached ...
-
bioRxiv - Cell Biology 2020Quote: ... mT/mG mice (ICR;Sv129/J;C57BL/6) (Boerries et al., 2013) were provided from the Huber laboratory (III Medical Clinic, UKE, Hamburg-Eppendorf). Mice had free access to water and standard chow ...
-
bioRxiv - Microbiology 2020Quote: ... We collected individual consortia of host-epibiont cells using an Eppendorf PatchMan NP2 micromanipulator equipped with 6 μm-diameter microcapillaries (Eppendorf) mounted on a Leica Dlll3000 B inverted microscope ...