Labshake search
Citations for Eppendorf :
101 - 150 of 1322 citations for 4 4 Fluoro 2 hydroxyphenyl methyl 2 6 bis 1 methylethyl 5 propyl 3 pyridinemethanol since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... This isolation method included a penultimate centrifugation step in Eppendorf polypropylene conical tubes (10,000 x g for 30 min at 4°C, in Eppendorf rotor F-34-6-38) that allowed the removal/isolation of larger microvesicles ...
-
bioRxiv - Systems Biology 2021Quote: ... Total volume of 20 mL from each culture was transferred to a 50 mL Falcon® filled with ice and was immediately centrifuged at 3000 rpm for 3 min at 4 °C (Eppendorf centrifuge). Next the supernatant was discarded and the cell pellet was snap frozen into liquid nitrogen and stored at -80 °C ...
-
bioRxiv - Systems Biology 2021Quote: For the extraction of total proteome 10 mL of each culture were transferred into ice-cold 15 mL Falcon® tubes which were centrifuged immediately at 3000 rpm for 3 min at 4 °C (Eppendorf centrifuge). The supernatant from the centrifugation was discarded and the cell pellets were washed once with 1 mL of cold PBS buffer ...
-
bioRxiv - Plant Biology 2023Quote: ... The primers were annealed at 95°C for 4 min followed by 70°C for 3 min in a thermocycler (Eppendorf, Hamburg, Germany). The reaction was allowed to cool slowly to room temperature ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... and InjectMan NI 2 (Eppendorf). Cas9 protein (500 ng/μL) ...
-
bioRxiv - Biophysics 2024Quote: ... a 2 mL tube (Eppendorf), containing 1 mL of a 2% BSA + 0.2% FBS in PBS solution ...
-
bioRxiv - Biophysics 2024Quote: ... A 2 mL tube (Eppendorf), containing a suspended cells at a 5 million per mL concentration in a 2% BSA + 0.2% FBS in PBS solution ...
-
bioRxiv - Microbiology 2021Quote: ... The samples were immediately cooled on ice and centrifuged for 12 min at 4°C and 3700 rpm (Centrifuge 5920 R, S-4×1000, Eppendorf). The cell pellets were stored at −20°C until RNA extraction.
-
bioRxiv - Microbiology 2021Quote: ... The cells were transferred into anaerobic 50 mL reaction tubes inside the anaerobic chamber and harvested outside of the anaerobic chamber for 12 min at 4°C and 3700 rpm (Centrifuge 5920 R, S-4×1000, Eppendorf). The supernatant was discarded inside the anaerobic chamber and the pellet was resuspended in fresh RCM medium to an OD600 of 5-10 ...
-
bioRxiv - Neuroscience 2024Quote: Suspensions were centrifuged at 4°C in 50 mL centrifuge tubes (Falcon) with a 5810R centrifuge and an A-4-81 rotor (Eppendorf) and in 38.5 mL polyallomer Ultra Clear ultracentrifuge tubes (Beckman Coulter ...
-
bioRxiv - Cell Biology 2022Quote: ... and InjectMan®4 micromanipulator (Cat#. 5192000035, Eppendorf) using external continuous pressure ...
-
bioRxiv - Immunology 2021Quote: ... at 10.000 rpm and 4°C (Eppendorf 5804R), for the removal of residual titanium [16].
-
bioRxiv - Cell Biology 2022Quote: ... for 10 minutes at 4°C (Eppendorf, Germany), and supernatants were transferred into fresh tubes to be evaporated to dryness in a CentreVap concentrator at 40°C (Labconco ...
-
bioRxiv - Bioengineering 2024Quote: ... 15 min at 4°C (Eppendorf, Hamburg, Germany). duRNA was generated through equimolar annealing of trRNA/crRNA in duplex buffer (IDT) ...
-
bioRxiv - Microbiology 2024Quote: ... or MasterCycler EP Realplex 4 thermal cycler (Eppendorf). Data were analyzed using recA and gyrA as internal controls ...
-
bioRxiv - Paleontology 2020Quote: ... 5 mg of bone powder was transferred to a 2 mL Eppendorf® tube (Eppendorf; Westbury, NY, USA) and 1 mL of demineralizing solution (5% trifluoroacetic acid (TFA ...
-
bioRxiv - Systems Biology 2024Quote: ... Leaf rosettes were pooled from 5 plants per biological replicate in 2 ml microcentrifuge tubes (Safelock®, Eppendorf) containing two ...
-
bioRxiv - Microbiology 2024Quote: ... Pellets were washed with cold 70% ethanol and centrifuged at 19,000 × g for 5 min at 4°C and air dried for 15 min in the Centrifugal Vacuum Concentrator 5301 (Eppendorf, USA). The quality of RNA was assessed using a NanoDrop (ND-1000 ...
-
bioRxiv - Microbiology 2024Quote: ... The stationary pre-cultures were then pooled and washed by centrifugation (5 min, 3,220 g and 4 °C) using a 5810 R swing-out centrifuge (Eppendorf, Hamburg, Germany). After centrifugation ...
-
bioRxiv - Immunology 2022Quote: ... Purified IgG was digested into F(ab’)2 with 200 μg of IdeS per 10 mg of IgG for 6 hr on a thermal mixer (Eppendorf ThermoMixer C) at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... pelleted by centrifugation (300 rcf, 3 min, RT in 50-mL conical tubes; then 21,000 rcf, 2 min, RT in Eppendorf tubes), and stored at -80 °C ...
-
bioRxiv - Microbiology 2021Quote: ... pelleted by centrifugation (300 rcf, 3 min, RT in 15-mL conical tubes; then 21,000 rcf, 2 min, RT in Eppendorf tubes), and stored at -80 °C until further analysis ...
-
bioRxiv - Microbiology 2021Quote: ... pelleted by centrifugation (300 rcf, 3 min, RT in 50-mL conical tubes; then 21,000 rcf, 2 min, RT in Eppendorf tubes), and sonicated in chilled PBS (1 s on ...
-
bioRxiv - Physiology 2020Quote: ... with 3 mM Tris(2-carboxyethyl)phosphine hydrochloride(TCEP-HCl) (Thermo Pierce) while shaking at 600 rpm in a thermomixer (Eppendorf). Samples were alkylated with 9 mM iodoacetamide (22 °C ...
-
bioRxiv - Biochemistry 2022Quote: ... 0.01% Tween 20) for 1 h at 4 °C and 1200 rpm in a thermomixer (Eppendorf). Unbound protein was removed by washing 2x with high salt buffer (50 mM HEPES pH 7.5 ...
-
bioRxiv - Molecular Biology 2022Quote: ... Cell pellets of OD600 = 3-6 units (as measured using an Eppendorf BioPhotometer) were resuspended in 300 µL of 20 % TCA and 100 µL of acid-washed glass beads ...
-
bioRxiv - Biophysics 2020Quote: ... The cell suspension was subsequently centrifuged for 30 min at 4°C and 3250 × g (Eppendorf Swing-bucket rotor A-4-62). The supernatant was discarded ...
-
bioRxiv - Cell Biology 2020Quote: ... and the cells were pelleted by centrifugation at approximately 250 × g for 5 min at 4 °C (Eppendorf 5804 R, Hamburg, Germany). After resuspension ...
-
bioRxiv - Plant Biology 2024Quote: ... The supernatant was collected after centrifugation at 4 °C for 5 min at 5000 g and dried using a SpeedVaq (Eppendorf, Montesson, France). Then ...
-
bioRxiv - Immunology 2024Quote: ... stool suspensions of feces (in H2O) were centrifuged at 16000 rpm and 4°C for 5 min using an Eppendorf 5427R centrifuge (Eppendorf; Hamburg, Germany). 100 µL of supernatant were mixed with 400 µL of ice-cold methanol containing recovery standards for evaluation of the quality of cell harvest and correction for variations ...
-
bioRxiv - Immunology 2024Quote: ... Before preparation for LC-MS analysis each sample was centrifuged at 16000 rpm and 4°C for 5 min using an Eppendorf 5427R centrifuge (Eppendorf; Hamburg, Germany). From each supernatant 350 µL were pipetted into two separate LC vials ...
-
bioRxiv - Cancer Biology 2024Quote: ... on a RealPlex 2 Thermocycler (Eppendorf).
-
bioRxiv - Microbiology 2024Quote: ... and Mastercycler ep Realplex 2 (Eppendorf). Data was normalized by GAPDH or sigA expression level and all primers were designed using GenScript primer design software ...
-
bioRxiv - Cell Biology 2023Quote: ... The micromanipulator (Eppendorf InjectMan NI 2) was positioned and microinjection was performed using microinjector (Eppendorf FemtoJet ...
-
bioRxiv - Immunology 2022Quote: ... The micromanipulator (Eppendorf InjectMan NI 2) was mounted on an Andor Spinning Disc Microscope and microinjection was performed using the microinjector FemtoJet with a 100X oil immersion objective to facilitate immediate visualization and image acquisition after microinjection ...
-
bioRxiv - Microbiology 2024Quote: ... transferred to 2-ml tubes (Eppendorf), harvested by centrifugation at 7000 x g for 7 minutes and stored at –80°C until DNA isolation (see below).
-
bioRxiv - Biochemistry 2024Quote: ... (2) 200 μL pipette (Eppendorf, Germany), (3 ...
-
bioRxiv - Biochemistry 2022Quote: ... 4 °C for 10 sec (5424-R Eppendorf microfuge) and the pellet was resuspended with 400 μl TES Solution (10 mM Tris-HCl ...
-
bioRxiv - Biophysics 2021Quote: ... 20°C for 4 hours (Thermomixer 5355 R, Eppendorf). After incubation ...
-
bioRxiv - Molecular Biology 2022Quote: ... Reactions were performed in a Realplex 4 Thermocycler (Eppendorf) using the following program ...
-
bioRxiv - Microbiology 2024Quote: ... 4°C for 20 minutes (Eppendorf® 5418 R) to collect all the cells ...
-
bioRxiv - Genetics 2024Quote: ... 000 RPM for 10 minutes at 4°C (Eppendorf), followed by transfer of the plasma to tubes ...
-
bioRxiv - Genetics 2024Quote: ... the samples were washed 3 times with 500 μl Perm wash (centrifugation for 2 minutes at 1600 rpm (Eppendorf centrifuge 5415R)) ...
-
bioRxiv - Biochemistry 2020Quote: ... The rest of the solution was incubated at 4 °C for 1 h on a thermomixer (Eppendorf) set to 1000 rpm ...
-
bioRxiv - Molecular Biology 2020Quote: ... Cell debris was removed via centrifugation at 13,000g for 1 hour at +4°C (Eppendorf 5810r centrifuge). A 1 ml HisTrap FF Crude chromatography column (GE Healthcare ...
-
bioRxiv - Microbiology 2024Quote: ... a fraction of the spore suspension (2 mL, in 2 mL Eppendorf tubes (Eppendorf SE®, DE) was re-suspended in physiological water instead of Milli-Q® Water and stored at 4°C for one week ...
-
bioRxiv - Cell Biology 2020Quote: Germinal vesicle intact oocytes were microinjected with ~5 pL of cRNAs in M2 medium containing milrinone at room temperature with a micromanipulator TransferMan NK 2 (Eppendorf) and picoinjector (Medical Systems Corp.) ...
-
bioRxiv - Neuroscience 2021Quote: ... EGFP RVS 5’-3’= TGTGGCGGATCTTGAAGTTAG on a Mastercycler Pro (Eppendorf) thermocycler PCR machine ...
-
bioRxiv - Biochemistry 2022Quote: ... and samples were vortexed at 1200 rpm for 2-3 hours at room temperature (MixMate ®, Eppendorf South Pacific, Sydney, NSW Australia). Following this ...
-
bioRxiv - Neuroscience 2020Quote: ... for 30 min at 4°C on centrifuge (Eppendorf #5804R) and rotor (Eppendorf #S-4-72) ...