Labshake search
Citations for Thermo Fisher :
301 - 350 of 10000+ citations for rno mir 125b 5p RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... cDNA was synthesized with oligo(dT)20 primers with Invitrogen’s SuperScript® III First-Strand Synthesis System for RT-PCR (Invitrogen, Germany), according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... were used to amplify target genes and 18S rRNA primers were used to amplify endogenous control by using the QuantStudio 6 Flex RT-PCR system (Applied Biosystems). Relative quantities of viral and cellular RNA were calculated using the standard curve method 12,59.
-
bioRxiv - Genomics 2022Quote: ... Bisulfite-PCR was conducted using primer sets (Integrated DNA Technologies; Table 1) designed against specific genomic regions with Methyl Primer Express v1.0 software (Thermofisher Scientific). PCR amplicons were cleaned with AmpureXP beads (#A63882 ...
-
bioRxiv - Neuroscience 2021Quote: ... the shRNA construct was obtained by cloning the sequence into pcDNA6.2-GW/EmGFP-miR plasmid using a microRNA (miR)-based expression vector kit (BLOCK-iT Pol II miR; Invitrogen), thereby creating an expression cassette consisting of the 5′ miR flanking region ...
-
bioRxiv - Biochemistry 2023Quote: ... with specific miR inhibitors (MH10203 for hsa-miR-22-3p and MH13382 for hsa-miR-1220-3p; Thermo Scientific) using Lipofectamine RNAiMax ...
-
bioRxiv - Neuroscience 2021Quote: ... Primers for qRT-PCR were designed using Primer Express Software (Applied Biosystems) for the housekeeping and test genes ...
-
bioRxiv - Microbiology 2021Quote: ... RT-PCR was performed using SuperScript III One-Step RT-PCR Kit with Platinum Taq (Invitrogen, USA) and the following cycling conditions ...
-
bioRxiv - Microbiology 2021Quote: ... RT-PCR was performed using SuperScript III One-Step RT-PCR Kit with Platinum Taq (Invitrogen, USA) according to the manufacturers’ recommendations ...
-
bioRxiv - Cell Biology 2020Quote: ... RT-Quantitative PCR (RT-qPCR) was performed on a 7900HT Fast Real-Time PCR System (Applied Biosystems) with Fast SYBR Green Master Mix (Applied Biosystems) ...
-
bioRxiv - Microbiology 2021Quote: ... RT-PCR was performed using the SuperScript® IV One-Step RT-PCR kit (Thermo Fisher Scientific). Nine cDNA fragments (gF1 to gF9 ...
-
bioRxiv - Microbiology 2020Quote: ... Real-time RT-PCR assays were performed using AgPath-ID One Step RT-PCR kit (Life Technologies) and an ABI 7500 Real Time PCR system was used to perform the RT-PCR reactions 8 ...
-
bioRxiv - Biochemistry 2023Quote: ... RT quantitative PCR was performed using the Applied Biosystems StepOnePlus™ RT PCR system (Thermo Fisher Scientific) with FastStart Universal SYBR Green Master (Roche Applied Science ...
-
bioRxiv - Genetics 2021Quote: ... All primers for real time RT-qPCR were purchased from Invitrogen Life Technologies and sequences of the primers are listed in Supplementary Table 1.
-
bioRxiv - Bioengineering 2021Quote: ... RT-qPCR was performed using TaqMan primer-probe mixes (Thermo Fisher) in a StepOnePlus system (Applied Biosystems ...
-
bioRxiv - Biochemistry 2023Quote: ... Excessive RT primer was digested with ExoSAP-IT (Applied Biosystems 78250). The resulting cDNA was adapted for barcoding by 10-cycle of PCR amplification and the dsDNA was purified by PureLink PCR Micro kit (Invitrogen K310010) ...
-
bioRxiv - Cancer Biology 2022Quote: ... and RT specific primers for miRNAs (ThermoFisher Scientific, See Table S9). 2.5 uL of RT product were pre-amplified for 14 cycles using the TaqMan PreAMP Mastemix and miRNA Taqman assay (see Table S9) ...
-
bioRxiv - Biochemistry 2024Quote: ... an oligo (dT)20 primer and Superscript III RT (Invitrogen, CA). Gene expression of SmNPP5 or SmAP was measured by quantitative real time PCR (RT-qPCR) ...
-
bioRxiv - Microbiology 2019Quote: The group-specific quantification of the nosZ genes in the activated sludge samples were performed with the designed primer and probe sets (Table 1) on a QuantStudio 3 real-time PCR instrument (Thermo Fisher Scientific, Waltham, MA) using TaqMan detection chemistry (FAM as the reporter and NFQ-MGB as the quencher) ...
-
bioRxiv - Microbiology 2021Quote: ... RT-qPCR was then performed using the AgPath RT-PCR (Life Technologies) kit on a QuantStudio™ 7 Flex Real-Time PCR System with the primers specific for SARS-CoV-2 E gene 48 ...
-
bioRxiv - Microbiology 2022Quote: ... RT-PCR was carried out with Superscript one step RT kit (Invitrogen). Primers used are indicated in Table 4 ...
-
bioRxiv - Microbiology 2022Quote: ... RT-qPCR was then performed using the AgPath RT-PCR (Life Technologies) kit on a QuantStudio™ 7 Flex Real-Time PCR System with the primers specific for SARS-CoV-2 E gene58 ...
-
bioRxiv - Cell Biology 2022Quote: ... 7µL of RT-PCR mix (Superscript III RT/platinium Taq 0,1µL (Invitrogen), Reverse and Forward primers and spikes at 1,33µM final concentration and homemade 2X reaction Mix (120mM Tris SO4 pH=9 ...
-
bioRxiv - Genomics 2020Quote: ... Standard quantitative RT-PCR (TaqPath 1-step RT qPCR Master Mix, Thermofisher) was run with test RNA and gene-specific standard curves (2e5 copy/mL – 20 copy/mL) ...
-
bioRxiv - Neuroscience 2020Quote: ... All PCR primers were synthesized by Invitrogen. Primer list and the primer sequences are available in SI Appendix.
-
bioRxiv - Neuroscience 2020Quote: ... All PCR primers were synthesized by Invitrogen with PPIA ...
-
bioRxiv - Molecular Biology 2019Quote: ... PCR primers were custom-synthesized by Invitrogen-Life Technologies or Integrated DNA Technologies ...
-
bioRxiv - Neuroscience 2020Quote: ... All PCR primers were synthesized by Invitrogen and designed for the human sequences of cholesterol biosynthesis pathway genes ...
-
bioRxiv - Neuroscience 2023Quote: ... All PCR primers were synthesized by Invitrogen with PPIA as the housekeeping gene (for primer sequences see Supplementary Table 2).
-
bioRxiv - Cancer Biology 2019Quote: ... anti-miR control or anti-miR-16 (Life Technologies, Carlsbad, CA, USA), and pre-microRNA negative control or pre-microRNA-16 (Life Technologies ...
-
bioRxiv - Genomics 2024Quote: ... and miR-1 (Life Technologies, assay name: hsa-miR-1, cat# 4427975) following the manufacturer’s recommendations (Life Technologies ...
-
bioRxiv - Microbiology 2019Quote: ... qRT-PCR was performed in a multiplex format with 500 nM of ZIKV-specific primers and 250 nM of probes and a GAPDH-specific primer/probe set (4352339E, Applied Biosystems). The following ZIKV primer/probe sequences ...
-
bioRxiv - Microbiology 2019Quote: ... which was analyzed using a GAPDH-specific primer/probe set (ThermoFisher Scientific, Mm99999915_g1, #4331182).
-
bioRxiv - Microbiology 2019Quote: ... which was analyzed using a GAPDH-specific primer/probe set (ThermoFisher Scientific, Mm99999915_g1, #4331182). Arbitrary units were calculated as follows ...
-
bioRxiv - Microbiology 2020Quote: ... RNA was normalized to the endogenous 18S primer-probe set (Thermo Fisher Cat #4319413E).
-
bioRxiv - Microbiology 2019Quote: ... Expression of TotM was measured using primer/probe sets for TotM (Dm02362087_s1 ThermoFisher 4351372) and normalized to RpL32 (Dm02151827_g1 (ThermoFisher 4331182) ...
-
bioRxiv - Cell Biology 2019Quote: ... Single strand cDNA was synthesized from the mRNA fraction of the total RNA by using Oligo dT primer and Superscript III First-Strand Synthesis System for RT-PCR (Invitrogen, ThermoFisher Scientific) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: ... and antisense primer 3Vif (5-AGCTAGTGTCCATTCATTG-3) using a Superscript III single RT-PCR system with Platinum Taq DNA polymerase kit (Thermo Fisher Scientific) as per the manufacturers instructions ...
-
bioRxiv - Biochemistry 2021Quote: ... using 0.5 µM forward (PCRp3) and reverse primer (RTp1) and the SuperScript III One-Step RT-PCR system with Platinum Taq DNA polymerase (Thermo Fisher Scientific). Finally ...
-
bioRxiv - Cell Biology 2023Quote: ... RT-qPCR was performed with the respective human-specific sense and antisense primers and RT-SYBR™ Green PCR Master Mix (Applied Biosystems). Multiwell plates of 384 wells were run on a Viia 7 PCR System (Applied Biosystems) ...
-
bioRxiv - Neuroscience 2023Quote: ... Primers and cDNA samples were validated by RT-PCR with the primers given in Table 1 and Taq DNA Polymerase (Life Technologies #10342020), using the following thermocycler program: 95°C for 2 min ...
-
bioRxiv - Immunology 2023Quote: The cDNA was synthesized by reverse transcriptase using oligo(dT)20 primer from 5 µg total RNA by the SuperScrip III First-Strand Synthesis System for RT-PCR (Thermo Fisher Scientific). The NGS libraries for MiSeq (Illumina ...
-
bioRxiv - Physiology 2022Quote: ... and miR-140 (Invitrogen) expression using the QuantiTect SYBR Green PCR Kit ...
-
bioRxiv - Microbiology 2022Quote: Specific RT-PCRs using the SuperScript III One-Step RT-PCR System with Platinum Taq DNA Polymerase (Invitrogen) were run to verify the presence of Clostridiaceae species (65) ...
-
bioRxiv - Microbiology 2022Quote: ... RT-PCR was conducted using a SuperScript™ III One-Step RT-PCR kit (Invitrogen, Carlsbad, CA, USA) to amplify the extracted viral RNA (Qiagen) ...
-
bioRxiv - Microbiology 2019Quote: ... Quantitative RT-PCR was then performed with TaqMan RNA-to-Ct One-step RT-PCR kit (Applied Biosystems) using the following cycling conditions ...
-
bioRxiv - Immunology 2020Quote: ... RT-PCR was carried out using TaqMan® One-Step RT-PCR master mix reagents kit (Applied Biosystems) with HCV primers (sense S66 [ACGCAGAAAGCGTCTAGCCAT] and anti-sense A165 [TACTCACCGGTTCCGCAGA] ...
-
bioRxiv - Microbiology 2023Quote: ... RT–PCR was performed using a Superscript III One-Step RT-PCR kit (Thermo Fisher Scientific, CA, USA) and an ABI StepOnePlus PCR system (Applied Biosystems ...
-
bioRxiv - Neuroscience 2022Quote: ... along with two endogenous control miRNAs (miR-423-5p [MIMAT0004748] and let-7b-5p [MIMAT0000063]) was performed in 384-well format using TaqMan pre-spotted assays (Thermo Fisher Scientific) on a QuantStudio-12K-Flex system ...
-
bioRxiv - Microbiology 2021Quote: PCR primers and probes were designed with Primer Express version 3.0.1 (Thermo Fisher). All primers and probes were purchased from Eurofins.
-
bioRxiv - Genomics 2019Quote: ... and RT-PCR (Invitrogen, cat# 12574– 035) were performed for gene annotation and nucleotide sequencing correction ...