Labshake search
Citations for Thermo Fisher :
1 - 50 of 10000+ citations for Zika Virus NS1 Proteins since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2024Quote: ... Antibodies used: anti-Influenza A virus NS1 (PA5-32243, ThermoFisher), anti-acetyl-α-tubulin (Ly640 ...
-
bioRxiv - Microbiology 2024Quote: ... NS1 proteins were detected using DENV2 NS1 polyclonal antibody (1:1,000 ThermoFisher Scientific) with overnight incubation at 4 °C ...
-
bioRxiv - Microbiology 2020Quote: Zika virus RNA yields were assessed using real-time PCR on a 7500 Fast Real-Time PCR instrument (Thermo Scientific, Poland). ZIKV cDNA was amplified in a reaction mixture containing 1× TaqMan Universal PCR Master Mix (RT-PCR mix ...
-
bioRxiv - Immunology 2021Quote: ... NS1 (Invitrogen Cat #PIPA532243, 1:1000), NP (BioRad Cat#MCA400 ...
-
bioRxiv - Microbiology 2021Quote: ... were transfected with pcineo plasmids (0.4 μg) carrying the RSV codon-optimised NS1 or FLAG-NS1 WT or mutant constructs using Lipofectamine 2000 (Invitrogen) according to the manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2022Quote: ... Immunostaining of NS1 and TRIM25 was realized by using the following antibody combination: mouse anti-NS1/goat anti-mouse Alexa 488 (ThermoFisher Scientific) and rabbit anti-TRIM25 (abcam)/goat anti-rabbit Atto647N (sigma) ...
-
bioRxiv - Microbiology 2023Quote: ... anti-NS1 and anti-NS2 (all 1:2000, Thermo Fisher). Membranes were washed in PBS-T and incubated with fluorescent secondary antibody (anti-mouse or anti-rabbit conjugated to AlexaFluor488 or 647 ...
-
bioRxiv - Microbiology 2022Quote: ... and the concentration of total virus proteins were determined by a BCA protein assay kit (Thermo Fisher) (31 ...
-
bioRxiv - Immunology 2023Quote: ... The recombinant NS1 gene was cloned into the pTRC–His2c expression vector (Invitrogen) and expressed in the BirA-enzyme containing E ...
-
bioRxiv - Immunology 2022Quote: ... or mouse anti-Hepatitis C virus Core protein (clone C7-50, Life Technologies) were visualised using IRDye 800CW Donkey anti-Rabbit IgG or Goat anti-Mouse IgG (LiCor) ...
-
bioRxiv - Microbiology 2022Quote: ... The protein concentration of the purified virus preparations was determined using a BCA protein assay kit (Thermo Fisher Scientific) prior to the addition of lysis buffer ...
-
bioRxiv - Microbiology 2021Quote: ... The DNA sequence encoding RSV NS1 was cloned by in vitro recombination (Gateway technology; Invitrogen) from pDONR207 into the Y2H vector pPC97-GW to be expressed as a fusion protein with the GAL4 DNA-binding domain (GAL4-BD) ...
-
bioRxiv - Microbiology 2021Quote: ... Proteins from virus-infected cells were immunoprecipitated using protein G magnetic Dynabeads according to the manufacturer’s instructions (Invitrogen, Carlsbad, CA). Briefly ...
-
bioRxiv - Immunology 2023Quote: ... Media containing virus particles was first concentrated to 20x using 100K MWCO protein concentrator columns (Thermofisher). Concentrated virus was then incubated using 1:2000 DiD-Cell labelling solution (ThermoFisher V22887 ...
-
bioRxiv - Microbiology 2019Quote: ... Anti-NS1 antibody binding was detected by a biotinylated goat anti-mouse IgG secondary antibody solution (ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... BacMam 2.0 virus (Invitrogen, C10593).
-
bioRxiv - Microbiology 2019Quote: ... The purified virus was quantified using the bicinchoninic acid (BCA) protein assay kit (ThermoFisher Scientific, Waltham, MA, USA) following the manufacturer’s instructions.
-
bioRxiv - Neuroscience 2021Quote: ... Loss of virus was monitored by staining with anti-Sendai virus antibody (Invitrogen, cat #14649482).
-
bioRxiv - Neuroscience 2024Quote: ... Virus was diluted in sterile 0.9% w/v sodium chloride in low protein binding collection tubes (Life Technologies Ltd) and stored at 4°C ...
-
bioRxiv - Microbiology 2020Quote: ... and MDCK-NS1-GFP cells were maintained at 37°C and 5% CO2 in Dulbecco’s Modified Eagle Medium (DMEM, Gibco®) supplemented with 10% Fetal Bovine Serum (FBS ...
-
bioRxiv - Neuroscience 2020Quote: ... virus with Trypan Blue (Gibco, 1µl) was injected into the lateral ventricle using glass pipette (WPI) ...
-
bioRxiv - Immunology 2022Quote: ... Virus was diluted in OptiMem (ThermoFisher) and applied apically at a MOI 0.1 for two hours at 34,5°C with 5% CO2.
-
bioRxiv - Bioengineering 2023Quote: ... Varicella zoster virus solution (Fisher Scientific) was dropped onto a No.1 coverslip and dried on top ...
-
bioRxiv - Cell Biology 2023Quote: Cytotune OSKM Sendai virus (A16517, Invitrogen) and EmGFP reporter Sendai Virus (A16519 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Vesicular stomatitis virus glycoprotein-pseudotyped virus was produced by co-transfecting 293T cells using Lipofectamine 2000 (Invitrogen) with an shRNA transducing vector and 2 packaging vectors ...
-
bioRxiv - Immunology 2021Quote: ... 25 μl of virus was immediately mixed with 25 μl of serially diluted (2×) protein A/G purified IgG (ThermoFisher) from mouse sera (starting at 500 μg/ml ...
-
bioRxiv - Microbiology 2022Quote: ... Foci development was stopped by fixation with 4% formaldehyde and foci were then stained using a mouse-anti-NS1 antibody (1A5) (gift from Jacob Schlesinger, Rochester University) and a horseradish peroxidase (HRP) conjugated secondary anti-mouse antibody (ThermoFisher 31430). The foci were visualized by diaminobenzidine (DAB ...
-
bioRxiv - Microbiology 2023Quote: ... PA (1:250), PB2 (1:250), NS1 (1:250, PA5-32243 and NS2 (1:250, PA5-32234) were all purchased from Thermo Scientific, Rockford ...
-
bioRxiv - Immunology 2021Quote: ... Virus was titrated by adding serial dilutions of virus supernatant (8 replicates) on VeroE6 cells in DMEM (Gibco) containing 2% FBS ...
-
bioRxiv - Microbiology 2023Quote: ... Mice were anesthetized with ketamine-xylazine and infected intranasally with 5,000 PFU of the non-recombinant virus or 1,000 PFU of the recombinant virus in 50 μl of Dulbecco’s Modified Eagle Medium (DMEM) (Gibco). For antibody treatment ...
-
bioRxiv - Immunology 2024Quote: ... Infection was initiated by adding 100 µl of virus inoculum containing 100.000 PFU (MOI ∼0.5-1) in virus absorption medium (Gibco OptiPro Serum free medium + 1:100 Glutamax + 10 mM HEPES ...
-
Histone deacetylase inhibitors butyrate and bufexamac inhibit de novo HIV-1 infection in CD4 T-cellsbioRxiv - Microbiology 2020Quote: ... Pelleted virus was resolved in PBS (Gibco) and stored at −80°C until further usage ...
-
bioRxiv - Immunology 2019Quote: ... murine leukemia virus reverse transcriptase (RT; Invitrogen), and random hexamers (Applied Biosystems) ...
-
bioRxiv - Neuroscience 2021Quote: ... Fibroblasts were reprogrammed using Sendai virus (Invitrogen) in feeder-free conditions on Matrigel (Corning ...
-
bioRxiv - Cell Biology 2023Quote: ... and EmGFP reporter Sendai Virus (A16519, Invitrogen) were part of the Cytotune -iPS 2.0 Sendai Reprogramming kit and EmGFP Sendai Fluorescence Reporter kit ...
-
bioRxiv - Immunology 2024Quote: ... in virus growth medium (1X MEM [Gibco 11095080] ...
-
bioRxiv - Microbiology 2021Quote: ... Equal amounts of the cell lysate protein and equal volume of the virus pellet protein were resolved by SDS-PAGE (NuPAGE 4-12% Bis-Tris gel; Invitrogen/Thermo Scientific) and transferred onto nitrocellulose membrane by semidry transfer ...
-
bioRxiv - Microbiology 2022Quote: ... The levels of RNA corresponding to the N protein-encoding gene of SARS-CoV-2 were measured using the TaqMan Fast Virus 1-step Master Mix (Thermo Scientific). Each 20-μL reaction mixture contained 5.0 μL of 4× TaqMan Fast Virus 1-Step Master Mix ...
-
bioRxiv - Microbiology 2019Quote: ... The viral N-protein was labeled using a primary anti-Tula virus antibody(12) and a secondary anti-rabbit FITC conjugate (Invitrogen, USA). The viral Gc protein was stained using a mouse monoclonal antibody (#H1808-60B ...
-
bioRxiv - Bioengineering 2023Quote: ... The levels of RNA corresponding to the N protein-encoding gene of SARS-CoV-2 were measured using the TaqMan Fast Virus 1-step Master Mix (Thermo Scientific). Each 20-μL reaction mixture contained 5.0 μL of 4× TaqMan Fast Virus 1-Step Master Mix ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1μl of sample was mixed in 20μl final of SoFast-Green reaction mix containing 10nM of forward (CCGTCTTAAGTTTGATTTT) and reverse (AGAGGTGGACCAACTCGGTA) primers for MVMp NS1 gene amplification using the StepOnePlus real-time PCR system (Thermo Fisher Scientific). Primers targeting the 18S gene were used for normalization (forward ...
-
bioRxiv - Microbiology 2021Quote: ... Equal amounts of the cell lysate protein and equal volume of the virus pellet protein were resolved by SDS-PAGE (NuPAGE 4-12% Bis-Tris gel; Invitrogen/Thermo Scientific) and transferred onto nitrocellulose membrane by semidry transfer ...
-
bioRxiv - Microbiology 2020Quote: ... or P1 SARS-CoV-2/München- 1.1/2020/929 (Munich) virus was diluted to 500 µl in 15 ml with virus dilution medium (Opti-MEM, Gibco) supplemented with 2% (v/v ...
-
bioRxiv - Microbiology 2023Quote: ... Next day cells were washed with phosphate-buffered saline (PBS) and infected with virus in Virus Production Serum Free Media (VPSFM; Gibco) supplemented with 0.25-0.5 ug/mL TPCK-Trypsin ...
-
bioRxiv - Immunology 2019Quote: ... and Moloney Murine Leukemia Virus reverse transcriptase (Invitrogen). Amplification of cDNAs was performed by quantitative real-time PCR reactions on a Light Cycler instrument (LC480 ...
-
bioRxiv - Microbiology 2020Quote: ... Virus was diluted in infection media (DMEM (Invitrogen) supplemented with 35% BSA (Sigma-Aldrich) ...
-
bioRxiv - Neuroscience 2021Quote: ... using Sendai virus-mediated transduction (Thermofisher Scientific, #A16517) or nucleofection (Amaxa ...
-
bioRxiv - Microbiology 2020Quote: ... and 50% virus solution in RPMI media (Gibco). Mosquitoes were left to feed for 1.5 h using Hemotek membrane feeder system (Discovery Workshops ...
-
bioRxiv - Immunology 2021Quote: ... virus was diluted in RPMI-1640 media (Gibco) and maintained on ice ...
-
bioRxiv - Neuroscience 2022Quote: ... virus was mixed with 4% fast green (Invitrogen) dissolved in saline and injected using a glass micropipette at a rate of 100 nl/min ...