Labshake search
Citations for Thermo Fisher :
501 - 550 of 5824 citations for VAPB Human His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... All pBAD inducible plasmids generated in this work were derived from pBAD/His A (Invitrogen). pJNS12 is pBAD-gfp-linker-virB flanked by NcoI and HindIII restriction sites ...
-
bioRxiv - Microbiology 2020Quote: ... Curli fibers were detected via direct fluorescent immunostaining with an α-6X-His antibody (Invitrogen) conjugated to a fluorescent dye ...
-
bioRxiv - Synthetic Biology 2021Quote: ... Ni-NTA coated magnetic beads (Dynabeads™ His-Tag Isolation and Pulldown from Invitrogen, USA) were added to the solution and incubated for 10 additional min in order to bind the his-tagged TDF and PKnG proteins ...
-
bioRxiv - Bioengineering 2020Quote: ... Isolated PBMCs were then cryopreserved in solution containing 90% heat-inactivated FBS (HI-FBS) (ThermoFisher) and 10% dimethyl sulfoxide (DMSO ...
-
bioRxiv - Systems Biology 2019Quote: ... The His tag was cleaved by overnight incubation at 4 °C with SUMO protease (Invitrogen), after which the sample was loaded again onto a HisTrap FF column to recover the cleaved products ...
-
bioRxiv - Developmental Biology 2020Quote: ... and verified by Western blot with primary antibodies against 6x His tag (Invitrogen, MA1-21315), and DLX1 (Abcam ...
-
bioRxiv - Molecular Biology 2020Quote: ... This synthetized gene was cloned into the Champion™ pET302/NT-His expression vector (Thermofisher) via EcoRI and XhoI restriction sites ...
-
bioRxiv - Microbiology 2020Quote: ... Enzyme and Fc-portion was removed on HIS-Pur Ni-NTA resin (Thermo Fisher Scientific) and Protein G sepharose (GE Healthcare ...
-
bioRxiv - Immunology 2021Quote: ... Anti-6x(HIS) anti-mouse antibody was used to recognize VHH (4A12E6: Invitrogen Rockford, USA) followed by probing with anti-mouse IgG raised in goat (A3562 ...
-
bioRxiv - Cell Biology 2020Quote: ... the constructs were all based on a pcDNA3.1 vector containing a V5/His-tag (Invitrogen). Untagged constructs for comparison were prepared by introducing a stop codon into the pcDNA3.1/V5-His constructs using the same site-directed mutagenesis kit as above ...
-
bioRxiv - Microbiology 2022Quote: ... Then 1 μl of Dynabeads™ His-Tag Isolation and Pulldown magnetic beads (ThermoFisher Scientific) were added into each well ...
-
bioRxiv - Microbiology 2022Quote: ... 0.02% Tween-20) and added to 20 μl Dynabead His-Tag beads (ThermoFisher Scientific; 10103D). After incubation on a roller at 4°C for 1 h ...
-
bioRxiv - Microbiology 2022Quote: ... VarG-HIS bands were excised and diluted with NuPAGE LDS sample buDer (Invitrogen, Carlsbad, CA) mixed with10 mM dithiotreitol (DTT ...
-
bioRxiv - Biochemistry 2022Quote: ... each with an N-terminal (His)6 tag from plasmids generated by GeneArt (ThermoFisher Scientific). For each purification ...
-
bioRxiv - Cancer Biology 2023Quote: ... containing 10% (v/v) heat-inactivated fetal bovine serum (HI-FBS; Thermo Fisher Scientific, 10099), penicillin (100 U/ml ...
-
bioRxiv - Microbiology 2023Quote: ... His-tagged proteins were visualised using a primary anti-6xhis antibody (ArtNr: 11533923, Fisher Scientific), a HRP-coupled secondary antibody (ArtNr ...
-
bioRxiv - Immunology 2022Quote: ... containing a hexa-His tag was purified using HisPur Ni-NTA resin (Thermo Fisher Scientific). Expi cell supernatants were diluted with 1/3 volume of wash buffer (20 mM imidazole ...
-
bioRxiv - Neuroscience 2022Quote: ... using an Ion PGM Hi-Q View Sequencing Kit (Thermo Fisher Scientific, Waltham, MA, USA) according to the manufacturer’s protocols.
-
bioRxiv - Cancer Biology 2023Quote: ... containing 10% (v/v) heat-inactivated fetal bovine serum (HI-FBS; Thermo Fisher Scientific, 10099), penicillin (100 U/ml) ...
-
bioRxiv - Molecular Biology 2023Quote: ... which were pre-loaded with 10 μL of Hi-Di™ formamide (ThermoFisher, Waltham, USA) and GeneScan™ -400HD ROX™ Size standard (ThermoFisher ...
-
bioRxiv - Genetics 2023Quote: ... This PCR fragment was TOPO cloned into pcDNA™3.1/V5-His backbone (Invitrogen, V81020). We used in vivo assembly cloning 40,41 for site directed mutagenesis to modify the nucleotide 1 bp upstream of the exon 49 splice junction to each of the alternative nucleotides (Supplementary table 1) ...
-
bioRxiv - Neuroscience 2023Quote: ... The His-tagged dAsapPZA protein was expressed and purified following the manufacturer’s guidelines (Invitrogen, USA).
-
bioRxiv - Immunology 2023Quote: ... Glycan samples were run with a LIZ 600 DNA ladder in Hi-Di formamide (ThermoFisher) on an ABI 3500xL DNA sequencer and analyzed with GlycanAssure Data Acquisition Software v.1.0 ...
-
bioRxiv - Biophysics 2023Quote: ... His-tag purification was performed in Pierce disposable polypropylene 5mL disposable columns (Thermo Fisher Scientific) with a wash solution containing TNi 100/300/20 (100 mM Tris-HCl pH 7.4 ...
-
bioRxiv - Cell Biology 2023Quote: ... The coding region for Hsc70-4 (CG4264) was cloned into pAc5.1/V5-His A (Invitrogen), and into pcDNA™6/myc-His A (Invitrogen) ...
-
A crucial role for dynamic expression of components encoding the negative arm of the circadian clockbioRxiv - Biochemistry 2023Quote: ... with the Ion PI™ Hi-Q™ Chef Kit (Thermo Fisher Scientific, Catalog # A27198) and Ion PI™ Chip Kit v3 (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2023Quote: ... or F-vec were cultured in DMEM + 10% HI FBS with Zeocin (Thermo Fisher Scientific) selection ...
-
bioRxiv - Immunology 2023Quote: ... and cryopreserved in heat-inactivated fetal-bovine serum (HI-FBS, ThermoFisher Gibco™ #12484028, USA) + 10% (v/v ...
-
bioRxiv - Immunology 2023Quote: ... and cryopreserved in heat-inactivated fetal-bovine serum (HI-FBS, ThermoFisher Gibco™ #12484028, USA) + 10% (v/v ...
-
bioRxiv - Molecular Biology 2023Quote: ... in HepG2 medium (Advanced MEM minus L-Glutamine [Gibco] + 10% [v/v] HI-FBS [Gibco] + 1% [v/v] penicillin-streptomycin + 2 mM Glutamax [Gibco] and 0.1% [v/v] amphotericin B) ...
-
bioRxiv - Immunology 2023Quote: ... The pIgR gene was inserted into the pEF-Myc-His vector (ThermoFisher Scientific, MS, USA).
-
bioRxiv - Neuroscience 2023Quote: ... rattus Piccolo (2622-2937) DNA was cloned into vector pCDNA3.1-myc-his(C) vector (Invitrogen).
-
bioRxiv - Molecular Biology 2023Quote: ... One microliter of sample was diluted in 9 ul Hi-Di™ Formamide (Applied Biosystems) containing 0.25 ul GeneScan™ 600 LIZ™ Size Standard ...
-
bioRxiv - Synthetic Biology 2023Quote: ... The PVDF membrane was then incubated with anti-his mouse primary antibody (Thermo Scientific Pierce) in TBS-T (1:5000 ...
-
bioRxiv - Developmental Biology 2023Quote: ... We also subcloned this cassette into a pAc5.1/V5-His A plasmid (Invitrogen #V4110-20) by cutting the cassette out of pUASP-attb-Cry2-CTEV-mCherry using NotI and XbaI (NEB #R3189S and #R0145S ...
-
bioRxiv - Microbiology 2023Quote: ... His-tagged LCRIS_00661 and LCRIS_00558 genes with the appropriate restriction sites were ordered from Invitrogen and subcloned into a previously constructed S ...
-
bioRxiv - Microbiology 2024Quote: Dynabeads™ His-Tag Isolation and Pulldown magnetic bead solution (Thermo Fisher Scientific, United States) kit was used for the detection of the binding partner of OipA ...
-
bioRxiv - Cell Biology 2024Quote: ... Western blotting was performed using an anti-His tag monoclonal rabbit antibody (Thermo Fisher Scientific) and GST monoclonal mouse antibody (own antibody) ...
-
bioRxiv - Bioengineering 2021Quote: ... + 2% human serum albumin (ThermoFisher) + 5 μM ROCKi (Tocris) ...
-
bioRxiv - Cell Biology 2020Quote: ... Human GR-specific siRNA (Invitrogen) was used at a concentration of 100 nM for 48 h to effectively knock down GR ...
-
bioRxiv - Cancer Biology 2020Quote: ... Human primary melanocytes (Life Technologies) were grown in Medium 254 (Gibco ...
-
bioRxiv - Microbiology 2019Quote: ... including human 293FT cells (Invitrogen), rat2 cells (ATCC #CRL-1764) ...
-
bioRxiv - Physiology 2019Quote: ... human GDF15 (Hs00171132_m1 - ThermoFisher Scientific), human GAPDH (Hs02758991_g1 – ThermoFisher Scientific) ...
-
bioRxiv - Physiology 2019Quote: ... human GAPDH (Hs02758991_g1 – ThermoFisher Scientific), mouse HPRT (Forward – AGCCTAAGATGAGCGCAAGT ...
-
bioRxiv - Genetics 2019Quote: ... human COT-1 DNA (Invitrogen) and biotin-labeled mouse COT-1 or minor satellite DNA (a gift from Dr ...
-
bioRxiv - Genetics 2021Quote: ... human COT-1 DNA (ThermoFisher) to detect HSA21 and biotin-labeled I-EGFP-I-loxP-3’HPRT (ThermoFisher ...
-
bioRxiv - Bioengineering 2021Quote: ... recombinant human Vitronectin (Gibco A14700) was used at a final concentration of 25ug/ml ...
-
bioRxiv - Cancer Biology 2020Quote: Human recombinant IL-1β (ThermoFisher) was reconstituted in deionised water and administered at 10 ng/ml.
-
bioRxiv - Cell Biology 2021Quote: ... human FMR1 (Ambion, USA, 4392420) and human ATF4 (Ambion ...
-
bioRxiv - Molecular Biology 2022Quote: ... AlexaFluor633 anti-human (all ThermoFisher) used 1:2000 in PBS with 0.2% BSA ...