Labshake search
Citations for Thermo Fisher :
401 - 450 of 10000+ citations for TIM 3 Human HEK 293 Fc His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... T-Rex-293 (Invitrogen), IMCD3 Flp-In ...
-
bioRxiv - Biochemistry 2021Quote: ... Expi-293 cells (ThermoFisher) were mock transfected or transfected with pWT-SARS-2-spike or pD614G-SARS-2-spike described for pseudovirus assays above ...
-
bioRxiv - Molecular Biology 2023Quote: ... Expifectamine 293 Enhancers (GIBCO) were added to the cells.
-
bioRxiv - Neuroscience 2023Quote: Expi 293 cells (ThermoFisher) were used for scFv expression ...
-
bioRxiv - Immunology 2024Quote: 293-F (ThermoFisher, #R79007) and Expi293F cells (ThermoFisher ...
-
bioRxiv - Biophysics 2021Quote: A human embryonic kidney cell line (HEK-293T) were maintained in Dulbecco’s Modified Eagle’s Medium (DMEM, GIBCO) and Jurkat T-lymphocytes were maintained in RPMI (GIBCO) ...
-
bioRxiv - Cell Biology 2023Quote: Human embryonic kidney (HEK) 293T and Vero cells were grown in Dulbecco’s modified Eagle medium (DMEM) (Gibco) supplemented with 10 % fetal bovine serum (FBS ...
-
bioRxiv - Systems Biology 2024Quote: Human embryonic kidney (HEK) 293T cells were maintained in Dulbecco’s Modified Eagle’s Medium (DMEM) media (ThermoFisher, UK), supplemented with 10% Heat Inactivated Foetal Bovine Serum (FBS ...
-
bioRxiv - Biophysics 2024Quote: Human embryonic kidney (HEK) 293T (#CRL-3216, ATCC) cells were maintained in DMEM GlutaMAX medium (#61965026, Gibco) supplemented with 10% fetal bovine serum and 1% penicillin-streptomycin (#15140122 ...
-
Polo-like kinase 1 independently controls microtubule-nucleating capacity and size of the centrosomebioRxiv - Cell Biology 2020Quote: ... elegans γ-tubulin complex was reconstituted by co-expression in human FreeStyle 293-F cells (Thermo Fisher Scientific). The GIP-2 and γ-tubulin (TBG-1 ...
-
Targeted degradation of PCNA outperforms stoichiometric inhibition to result in programed cell deathbioRxiv - Cell Biology 2022Quote: Human embryonic kidney T-REx 293 cells which express the tetracycline repressor protein were purchased from Thermo Fisher Scientific and cultured in Eagle’s Minimum Essential Medium (MEM ...
-
bioRxiv - Microbiology 2021Quote: ... Recombinant human IgG1 mAbs were produced by co-transfection of Freestyle 293-F suspension cells (Thermo Fisher Scientific) as previously described 57 and purified by affinity chromatography using protein G sepharose 4 fast flow beads (GE Healthcare).
-
bioRxiv - Microbiology 2022Quote: ... Recombinant human IgG1 mAbs were produced by co-transfection of Freestyle 293-F suspension cells (Thermo Fisher Scientific) as previously described 48 and purified by affinity chromatography using protein G sepharose 4 fast flow beads (GE Healthcare).
-
bioRxiv - Microbiology 2023Quote: Human 293F cells were maintained at 37°C with 5-8% CO2 in FreeStyle 293 Expression Medium (ThermoFisher) supplemented with penicillin and streptomycin ...
-
bioRxiv - Biochemistry 2023Quote: Human Embryonic Kidney Cells 293 (HEK293T cell) were cultured in Dulbecco’s modified Eagle’s medium (DMEM) (Thermo Scientific™) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Microbiology 2022Quote: ... pTG-Luc and SARS2-COV2 spike expression vector were transfected into HEK 293T cells at the ratio of 3:4:3 using Lipofectamine 3000 transfection reagent (ThermoFisher Scientific, Waltham, MA). Accession IDs of the spike proteins used in the study were ...
-
bioRxiv - Biochemistry 2020Quote: Freestyle 293-F cells were grown in Freestyle 293 expression medium (Thermo Fisher) in suspension culture ...
-
bioRxiv - Genomics 2024Quote: Freestyle 293-F cells were grown in Freestyle 293 Expression Medium (ThermoFisher Scientific) at 37°C and 8% CO2 while shaking at 135 rpm ...
-
bioRxiv - Biochemistry 2023Quote: ... Freestyle 293 Expression Medium and Expi 293 Expression Medium were purchased from Gibco, along with Expi293F cells and the ExpiFectamine 293 Transfection Kit ...
-
bioRxiv - Microbiology 2021Quote: ... which is composed of two ACE2 ectodomains linked to the Fc portion of the human IgG (Anand et al., 2020).Alexa Fluor-647-conjugated goat anti-human Abs (Invitrogen) were used as secondary antibodies to detect ACE2-Fc and plasma binding in flow cytometry experiments.
-
bioRxiv - Cancer Biology 2023Quote: ... and 10ng/ml recombinant human IL-3 (Gibco). Cultured cells were infected with lentivirus encoding GFP/Scrambled control shRNA overnight and fresh media was added the following day ...
-
bioRxiv - Microbiology 2020Quote: ... 3 μg of mammalian expression vector plasmids based on pEF1α V5 His C (Invitrogen) encoding codon-optimized gH ...
-
bioRxiv - Microbiology 2019Quote: ... the sequence coding for vpa0226 was amplified using primers 5’ GATCCTGCAGATGCTTAAAATTAAACTGCCT 3’ and 5’ GATA GAATTCTTACTTATCGTCGTCATCCTTGTAATC 3’ and then cloned into the pBAD/Myc-His vector (Invitrogen, resistance changed from ampicillin to kanamycin ...
-
bioRxiv - Developmental Biology 2021Quote: ... and HEK-A (ThermoFisher) were maintained in Dulbeccos Modified Medium (DMEM ...
-
Rab35 Governs Apicobasal Polarity Through Regulation of Actin Dynamics During Sprouting AngiogenesisbioRxiv - Developmental Biology 2022Quote: ... and HEK-A (ThermoFisher) were maintained in Dulbeccos Modified Medium (DMEM ...
-
bioRxiv - Bioengineering 2020Quote: HEK 293F cells (Invitrogen) were cultured in Freestyle medium (Gibco ...
-
bioRxiv - Cell Biology 2021Quote: ... and HEK-A (ThermoFisher) were maintained in Dulbeccos Modified Medium (DMEM ...
-
bioRxiv - Biophysics 2020Quote: ... HEK 293F cells (Invitrogen) were transfected with the four plasmids and harvested after 60 hours ...
-
bioRxiv - Cell Biology 2022Quote: HEK-293FT cells (Invitrogen) were cultured in 1x DMEM ...
-
bioRxiv - Immunology 2022Quote: HEK-293T cells (Invitrogen) were transfected using SARS-CoV-2 S expression plasmid expression vector and lipofectamine (thermofisher ...
-
bioRxiv - Immunology 2022Quote: ... 3×106 HEK-293T cells were seeded in 10ml of complete DMEM Dulbecco’s Modified Eagle’s Medium (Gibco) supplemented with 10% FBS and 50μg/ml penicillin-streptomycin ...
-
bioRxiv - Neuroscience 2023Quote: ... Full-length human LRRC4B was subcloned and inserted into the pcDNA6-V5-His vector (Invitrogen). FAM19A5 (NM_001252310.1 ...
-
bioRxiv - Neuroscience 2024Quote: ... After blocking supernatant samples from different groups and standards (recombinant human-TREM2-His; Life Technologies) were incubated for 2 h at room temperature (RT ...
-
bioRxiv - Immunology 2019Quote: ... and the ELISPOT plate was incubated with biotinylated goat anti-human IgG Fc (Invitrogen), followed by HRP-conjugated avidin (Vector Laboratories ...
-
bioRxiv - Cancer Biology 2020Quote: ... Then the cells were stained with AlexFuor488-conjugated goat anti human Fc (Life technologies) at RT for 30 min and analyzed by flow cytometry ...
-
bioRxiv - Immunology 2021Quote: ... Horseradish peroxidase (HRP)-conjugated antibody specific for the Fc region of human IgG (Invitrogen) was used as secondary antibody to detect antibody binding in ELISA experiments.
-
bioRxiv - Microbiology 2021Quote: ... 100 μL of HRP-labelled anti-human IgG Fc antibody (Catalog# 31413, Thermo Fisher) was added to each well and incubated for 1 hour ...
-
bioRxiv - Bioengineering 2021Quote: ... nanovials were modified with biotinylated goat anti-human IgG Fc antibody (Thermo Fisher Scientific). Samples were resuspended in DMEM and seeded in a well plate ...
-
bioRxiv - Microbiology 2022Quote: ... Horseradish peroxidase (HRP)-conjugated Abs specific for the Fc region of human IgG (Invitrogen) were used as secondary antibodies to detect antibody binding in ELISA experiments ...
-
bioRxiv - Immunology 2020Quote: ... Rabbit anti-Human IgG Fc HRP Secondary Antibody (ThermoFisher Scientific Catalog #31423, 1:10,000), and Rabbit anti-Human IgG F(ab’)2 HRP Secondary Antibody (ThermoFisher Scientific Catalog #31482 ...
-
bioRxiv - Biochemistry 2021Quote: ... and 0.25 µL Goat anti-Human IgG Fc PE conjugate (ThermoFisher #12-4998-82). Protease susceptibility measurements were performed in biological replicates (n = 2 ...
-
bioRxiv - Biochemistry 2021Quote: ... and 0.25 µL Goat anti-Human IgG Fc PE conjugate (ThermoFisher #12-4998-82). Titrations were performed in biological replicates (cultures from independent colonies grown on separate days ...
-
bioRxiv - Immunology 2020Quote: ... followed by addition to the Fc-chimeric human ACE2-coated MaxiSORP ELISA plate (Nunc) for an hour at room temperature ...
-
bioRxiv - Cell Biology 2023Quote: Human JAGGED1-Fc (Martin et al., 2023) was transfected into Expi293F cells (ThermoFisher, A14527) using FectroPro (Polyplus ...
-
bioRxiv - Immunology 2024Quote: ... Anti-Human Fc chip was regenerated to baseline using IgG Elution Buffer (Thermo Scientific) and the process was repeated for all humAbs in the panel ...
-
bioRxiv - Immunology 2021Quote: ... or in sterile Sorting Medium [RPMI 1640 supplemented with 10% (v/v) Heat-Inactivated Fetal Bovine Serum (HI-FCS; A3840001; Gibco)] ...
-
bioRxiv - Molecular Biology 2022Quote: Female human embryonic kidney cells HEK-293FT and male human fibrosarcoma HT1080 cells were cultured in DMEM-GlutaMAX + Pyruvate (Life Technologies SAS, Saint-Aubin, France), supplemented with 10% fetal bovine serum (FBS) ...
-
bioRxiv - Microbiology 2021Quote: ... HEK-293T overexpressing the human ACE2 were kindly provided by Integral Molecular Company and maintained in DMEM (Invitrogen) with 10% fetal bovine serum ...
-
bioRxiv - Microbiology 2020Quote: ... Human embryonic kidney (HEK) 293T cells (ATCC CRL-3216) were cultured in DMEM+GlutaMAX-I (Thermo Fisher Scientific) supplemented with heat-inactivated 8% FBS.
-
bioRxiv - Microbiology 2021Quote: ... HEK-293T overexpressing the human ACE2 were kindly provided by Integral Molecular Company and maintained in DMEM (Invitrogen) with 10% fetal bovine serum ...