Labshake search
Citations for Thermo Fisher :
501 - 550 of 10000+ citations for Recombinant Human CTRL Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2024Quote: ... we transfected keratinocytes in 24-well plates with 500ng/well circASH1L overexpressing plasmids (oe-cASH1L) or pcDNA3.1 vector (oe-ctrl) using LipofectamineTM 3000 reagent (ThermoFisher Scientific).
-
bioRxiv - Genomics 2024Quote: SW480 cells were transfected with 100 nM non-targeting siRNA control (Ctrl) or TOP1 siRNA duplexes listed in Table S7 (Dharmacon) using Lipofectamine 3000 (Invitrogen) according to the manufacturer’s directions (Life Technologies) ...
-
bioRxiv - Neuroscience 2019Quote: FLAG-tagged human LRRK2 proteins were enriched from injected rat striatum using Protein G-Dynabeads (50 µl; Invitrogen) pre-coupled with mouse anti-FLAG-M2 antibody (5 µg ...
-
bioRxiv - Immunology 2022Quote: ... Both recombinant LPS (100ng/ml) and recombinant IFNy (10 ng/ml, Gibco) were provided to cells for differentiation to classical macrophages ...
-
bioRxiv - Molecular Biology 2020Quote: ... Immulon 2 HB plates were coated with 2μg/ml Pierce recombinant protein A/G (ThermoFisher catalog no: 77677) or purified SARS-CoV-2 receptor binding domain (provided by Florian Krammer ...
-
bioRxiv - Molecular Biology 2021Quote: ... Supernatant was collected 6 days later and recombinant mAb was purified using protein A agarose (Thermo Fisher Scientific) according to the manufacturer’s protocol.
-
bioRxiv - Cancer Biology 2021Quote: Recombinant STUB1 protein (aa25-aa153) was dialyzed overnight with Slide-A-Lyzer cassette (7K MWCO, Thermo Scientific, #66373) in 1 liter of dialysis buffer (PBS ...
-
bioRxiv - Biophysics 2022Quote: ... The recombinant protein was expressed in the Pichia pastoris strain SMD1168H (Philosof et al., 2017) (Thermo Fisher Scientific). The cells were harvested 48–60 h after expression was induced in BMMY medium when 10 mM of all-trans-retinal (Sigma-Aldrich ...
-
bioRxiv - Biochemistry 2022Quote: ... Recombinant protein was captured on a Ni2+-NTA HisPur® affinity resin by gravity flow (Thermo Fisher Scientific). Unbound proteins were washed with binding buffer ...
-
bioRxiv - Microbiology 2020Quote: ... Expression and purification of recombinant proteins were performed according to manufacturer’s instructions (Invitrogen Corporation, Catalog no. K1710-01): YPD medium supplemented with 100 μg ml−1 zeocin was used for initial growth of P ...
-
bioRxiv - Biochemistry 2020Quote: The soluble recombinant protein was captured on a Ni2+-NTA affinity resin by gravity flow (Thermo Fisher Scientific). Unbound proteins were washed with 25 mM HEPES ...
-
bioRxiv - Immunology 2021Quote: ... Dinutuximab and dinutuximab LALA-PG were then purified using recombinant protein A-Sepharose 4B (ThermoFisher Scientific, Waltham, MA), buffer exchanged into antibody buffer (20mM L-Histidine ...
-
bioRxiv - Microbiology 2022Quote: The recombinant proteins named rS1Beta was purified using a CaptureSelect™ C-tagXL Affinity Matrix prepacked column (ThermoFisher) and followed the manufacturer’s guidelines ...
-
bioRxiv - Cancer Biology 2023Quote: Recombinant Endocan and PDGF-BB were labeled with Alexa Fluor 488 Microscale Protein Labeling Kit (Thermo Fisher Scientific) and Alexa Fluor™ 647 Microscale Protein Labeling Kit (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2021Quote: ... Anthony White (QIMR Berghofer Medical Research Institute, Australia) were maintained on human recombinant vitronectin in StemFlex medium (Life Technologies, cat. # A3349401). Differentiation was performed as previously described [15 ...
-
bioRxiv - Systems Biology 2020Quote: ... 72 h after seeding on 96-well microplates differentiated cells were incubated with recombinant human interferon gamma (IFN-γ, ThermoFisher, #PHC4031) at concentrations 0-10 ng/mL or recombinant human interleukin 10 (IL-10 ...
-
bioRxiv - Cell Biology 2020Quote: ... coated overnight with 10 μg/ml of xeno-free human recombinant Laminin 521 (LN521, Biolamina) prepared in GMP DPBS+/+ (A1285801, Life Technologies) by reversing the strainer and washing the EBs into the plate with GMP N2 media (CTS™ DMEM-F12 ...
-
bioRxiv - Immunology 2022Quote: ... Cells were incubated in RP-10 supplemented with 10 ng/ml recombinant human IL-2 and 2 μg/ml anti CD28 (clone 37.51, Thermo Fisher Scientific) for 18-22 hours ...
-
bioRxiv - Cancer Biology 2021Quote: ... supplemented with 10% fetal bovine serum (FBS)) and 30IU/mL recombinant human IL-2 (rhIL-2; Thermo Fisher Scientific, Waltham, MA).
-
bioRxiv - Cell Biology 2020Quote: ... HUVECs were treated with 30 ng/ml of VEGF (Recombinant Human Vascular Endothelial Cell Growth Factor, Fisher Scientific 10690920, Bordeaux, France) for 24 hours.
-
bioRxiv - Immunology 2021Quote: Purified CD8+ cells were cultured in AIMV medium supplemented with 10% FBS and 100 U/ml recombinant human IL-2 (ThermoFisher Scientific) and used for sorting of CD8+ T cell subsets and for further experiments three days after isolation.
-
bioRxiv - Cell Biology 2022Quote: ... 50 mM β- Mercaptoethanol and 1 ng/ml human recombinant leukemia inhibitory factor) for 24 h and then treated with 0.1 μg/ml Colcemid (Gibco, 15210-040) for 2.5 h ...
-
bioRxiv - Neuroscience 2023Quote: ... followed by a layer of 0.02 mg ml-1 human recombinant laminin (BioLamina) in DPBS containing Ca2+ & mg2+ (Thermo Fisher Scientific) was deposited on the electrode array ...
-
bioRxiv - Neuroscience 2023Quote: ... followed by a layer of 0.02 mg ml-1 human recombinant laminin (BioLamina) in DPBS containing Ca2+ and mg2+ (Thermo Fisher Scientific) was deposited on the electrode array ...
-
bioRxiv - Cell Biology 2023Quote: Saturating amounts of recombinant human (rh) EGFR-Biotin and rhPD-L1-Biotin (ACRO Biosystems) were coated onto separate Streptavidin-coated DynaBeads (Thermo Fisher) using manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... were cultured in complete RPMI (10% FCS, 1% Penicillin/Streptavidin, 1% HEPES) supplemented with recombinant human M-CSF (10 ng/mL, Life Technologies) for 7-10 days to differentiate monocyte-derived macrophages (MDM) ...
-
bioRxiv - Developmental Biology 2023Quote: Stem cells were grown on culture plates coated with 5micro μg ml-1 recombinant human Vitronectin (rhVTN-N, Life Technologies, #A14700). HESCs were grown in mTeSR1 (StemCell Technologies ...
-
bioRxiv - Cancer Biology 2023Quote: ... except for RWPE1 which were maintained in Keratinocyte Serum Free Medium supplemented with bovine pituitary extract and human recombinant epidermal growth factor (manufacturer supplied, Life Technologies). For spheroid cultures ...
-
bioRxiv - Cancer Biology 2023Quote: H357 and H376 cells at ∼80 % confluence were treated either with distilled water (as control) or with 20 ng/ml of Human Recombinant FGF2 (PHG0026, ThermoFisher Scientific) for 48 h ...
-
Pathogenic CD8 T cell responses are driven by neutrophil-mediated hypoxia in cutaneous leishmaniasisbioRxiv - Immunology 2023Quote: ... 20 U/mL recombinant human IL-2 at 37°C and 5% CO2 for 24 hours in RPMI 1640 (Gibco, Canada) containing 100 Units of penicillin and 0.1 mg/mL of Streptomycin (Sigma ...
-
bioRxiv - Neuroscience 2024Quote: ... 6-well plates were coated with 20 µg/mL Human recombinant laminin-521 (Biolaminin; Biolamina; LN521-05) in 1x dPBS++ (Gibco; 14040117) and incubated overnight at 4 °C ...
-
bioRxiv - Cancer Biology 2024Quote: ... supplemented with 5 ng/ml human recombinant epidermal growth factor (EGF) and 50 µg/ml bovine pituitary extract (BPE)(all Thermo Fisher). Above cells were split every 4-5 days using 5-10-minute incubation with 0.05% trypsin-EDTA (Thermo Fisher ...
-
bioRxiv - Developmental Biology 2021Quote: HRMEC viability and/or proliferation was assessed at 48 and 72 hours after transfection with si-SLC38A5 or si-Ctrl using a MTT cell metabolic activity assay kit (Cat# V13154, Life Technologies) as described previously (49) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Supernatants were transferred to a new tube and sera were either left untreated (CTRL) or diluted with either the recommended amount of TEI [Total Exosome Isolation Reagent from serum (Invitrogen, 4478360)] or different amounts of PEG precipitation solution (PPS) ...
-
bioRxiv - Molecular Biology 2024Quote: ... or the miRNA control (miR-CTRL-1: cel-miR67 miRIDIAN microRNA Mimic Negative Control #1 UCACAACCUCCUAGAAAGAGUAGA) was performed with Lipofectamine RNAiMAX (Life Technologies) following the manufacturer’s guidelines ...
-
bioRxiv - Microbiology 2019Quote: ... Recombinant RNase H (Invitrogen) was later added to the reverse transcribed samples and incubated for 20 min at 37°C ...
-
bioRxiv - Immunology 2022Quote: ... Recombinant B18R (Life Technologies) was used at 1ug/ml ...
-
bioRxiv - Neuroscience 2019Quote: ... All proteins were expressed in Human Embryonic Kidney (HEK) 293 Freestyle cells (Invitrogen) in suspension culture using serum-free media ...
-
bioRxiv - Immunology 2023Quote: ... RBD proteins were expressed in-house in Expi293F human cells (Thermo Fisher Scientific) by transfection of the cells with purified DNA and polyethylenimine (PEI) ...
-
bioRxiv - Biochemistry 2023Quote: Proteins from human cell lines were extracted in IP lysis buffer (Thermo Fisher Scientific ...
-
bioRxiv - Biochemistry 2022Quote: ... The Z-scores for reactivity of SARS CoV-2 proteins to each human protein was determined by using ProtoArray Prospector v 5.2 software (Invitrogen, Thermo Fisher).
-
bioRxiv - Developmental Biology 2021Quote: ... containing 500 μm disk patterns were coated with 10 μg/ml recombinant human laminin 521 (BioLamina) diluted in pre-warmed DPBS (Thermo Fisher Scientific) for 3 hours at 37°C ...
-
bioRxiv - Neuroscience 2019Quote: ... IPS cells were thawed and cultured at all times cultured on recombinant human laminin LN521 (Biolamina, 2021-21) kept in E8 basal medium (Thermo Fisher Scientific) supplemented with primocin (0.1 μg/ml ...
-
bioRxiv - Developmental Biology 2021Quote: ... ESCs were dissociated with TrypLE Express for 5 mins at 37°C and induced into EpiLCs by addition of human recombinant basic fibroblast growth factor (bFGF) (Invitrogen, 13256-029) and activin A (Peprotech ...
-
bioRxiv - Cell Biology 2021Quote: ... Phages displaying human Fabs were enriched after three rounds of biopanning on biotinylated recombinant human ACE2 immobilised to streptavidin Dynabeads (Dynal M-280, Invitrogen, cat # 112.06D). After the third round of panning ...
-
bioRxiv - Microbiology 2020Quote: ... To starve Chlamydia of tryptophan HeLa cells were incubated for 24 h in media containing 2 ng/ml recombinant human IFN-γ (Invitrogen: PHC4033) prior to infection ...
-
bioRxiv - Cell Biology 2020Quote: ... cells were pulsed in starvation buffer supplemented with 0.1% w/v bovine serum albumin at 4 °C for 40 min with 50 ng/mL human recombinant EGF (Thermo-Fisher, Gibco™, PHG0311L) to allow ligand bind to the EGFR ...
-
bioRxiv - Cell Biology 2020Quote: ... 0.055 mM β-mercaptoethanol (#21985-023) and recombinant human full-length bFGF (#PHG0261) at 10 ng/ml (all reagents from Life Technologies).
-
bioRxiv - Bioengineering 2022Quote: ... MDTs were exposed to a neutral culture medium or to a 20 ng/ml of TNF solution (Recombinant TNF alpha human; 300-01A, PeproTech, Thermo Fisher Scientific) in culture medium for either 30 minutes or 240 minutes ...
-
bioRxiv - Immunology 2023Quote: ... cells at the end of 1-day culture were pulsed for 20 minutes with 40 ng/ml of recombinant human IFN-γ (Gibco/Thermo Fisher), 100 IU/ml of recombinant human IL-2 (Roche Diagnostics ...