Labshake search
Citations for Thermo Fisher :
501 - 550 of 3080 citations for IFT122 siRNA since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2021Quote: ... ON-TARGET plus human MGEA5 (10724) siRNA-smartpool) or nontargeting siRNA (Dharmacon, ON-TARGETplus nontargeting pool) using Lipofectamine RNAiMAX (Invitrogen) as recommended by the manufacturer ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were transfected twice with 10 nM Silencer Select BRCA2 s2084 siRNA and 10 nM Silencer Select BRCA2 s2085 siRNA (Ambion) using Lipofectamine RNAiMAX (Invitrogen ...
-
bioRxiv - Bioengineering 2022Quote: ... Cells were transfected with 20 nM siRNA oligonucleotides and 20 nM negative control siRNA using Lipofectamine RNAiMax (Thermo Fisher Scientific) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2019Quote: HMF and MRC5 fibroblasts were transfected with a pool of 3 siRNAs targeting each of the 710 human kinases (Silencer Human Kinase siRNA Library, #A30079 Thermofisher). Fibroblasts (1250 cells/well ...
-
bioRxiv - Physiology 2020Quote: ... SiReverbα (Mouse NR1D1 ON-TARGETplus siRNA, Dharmacon) or SiReverbβ (Mouse NR1D2 ON-TARGETplus siRNA, Dharmacon) at 50nM concentration using Lipofectamine RNAiMAX (Invitrogen) as a transfection reagent ...
-
bioRxiv - Microbiology 2021Quote: ... A549 cells were transfected in suspension with 50 pmol per 3×105 cells of scrambled siRNAs (control, 5’UUCUCCGAACGUGUCACGU3’) or siRNAs specific for JIP4 (5’GAGCAUGUCUUUACAGAUCUU3’) using the transfection reagent LipofectamineR 2000 (Invitrogen) according to manufacturers’ instructions ...
-
bioRxiv - Cancer Biology 2019Quote: ... Ctrl siRNA (40nM) or DDX5 siRNA (40nM) were co-transfected with Renilla and Firefly luciferase vectors using RNAiMax (Life Technologies). Luciferase activity was measured 48hrs after transfection using Dual Luciferase Assay system ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were transfected with 20 nM siRNA oligonucleotides and 20 nM Negative Control siRNA using Lipofectamine(tm) RNAiMax (ThermoFisher Scientific) according to manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... and Arp2 siRNA (Dharmacon, ON-TARGET plus SMART pool siRNA, catalogue no. L-011195-00-0005) using Lipofectamine RNAiMAX (Invitrogen) on day 1 and day 2 ...
-
bioRxiv - Cell Biology 2021Quote: ... The βarr1/2 siRNA (5’-ACCUGCGCCUUCCGCUAUG-3’) and a scrambled siRNA (control, 5’-UGGUUUACAUGUCGACUAA-3’) (Dharmacon) were transfected by RNAimax (Invitrogen) according to the instructions of the manufacturer ...
-
Enhancer Remodeling Promotes Tumor-Initiating Activity in NRF2-Activated Non-Small Cell Lung CancersbioRxiv - Cancer Biology 2020Quote: ... Sumitomo Bakelite Co.) followed by transfection with 2 pmol/well of NRF2 siRNA (HSS107128) or control siRNA using RNAiMAX (Invitrogen). Spheroids were observed 24 and 96 hrs after transfection ...
-
bioRxiv - Cell Biology 2020Quote: K562 cells were grown in their respective media without antibiotics and transfected with siRNA against LC3 or control siRNA using lipofectamine RNAiMAX (Invitrogen) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... They were then transfected with either a control siRNA or siRNA against a gene of interest (Silencer Select, Life Technologies) at 30 nM by reverse transfection using RNAiMax (Life Technologies) ...
-
bioRxiv - Cancer Biology 2022Quote: ... primary human breast CAFs were transfected with 75 nm human periostin-targeting stealth siRNA (si-POSTN) (ThermoFisher siRNA ID: HSS116400) or 75 nm non-targeting control siRNA (si-Control ...
-
bioRxiv - Cell Biology 2022Quote: ... 8μl siRNAs and 6μl siRNA transfection reagent were diluted in each 100μl Opti-MEM™ media (Thermo Fisher, Cat# 31985062), then mixed and incubated for 5 min at room temperature ...
-
bioRxiv - Immunology 2022Quote: ... with siRNAs against SAMHD1 (sense RNA 5’-GCAGAUAAGUGAACGAGAUTT-3’, antisense RNA 5’-AUCUCGUUCACUUAUCUGCAG-3’) or the negative control #1 siRNA (Ambion). Three days after transfection with either siRNA or shRNA plasmids ...
-
bioRxiv - Microbiology 2022Quote: Loss of function of NEU1-4 was conducted by transfecting cells with pooled siRNAs (Supplemental Table 1) (Dharmacon) or single siRNAs (Supplemental Table 1) (ThermoFisher) using RNAiMAX (Invitrogen ...
-
bioRxiv - Molecular Biology 2022Quote: ... cells were transfected with a final concentration of 40 nM of a SmartPool siRNA against HMGN5 or a non-targeting SmartPool siRNA (purchased from Dharmacon) using Lipofectamine RNAiMax (Invitrogen) according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... 500pmol each of PP2Aca siRNA and PP2Acb siRNA were transfected into BMDMs (1×106 cells) by electroporation using the Neon Transfection System (Invitrogen) and electrical parameters of 1400V ...
-
bioRxiv - Microbiology 2022Quote: A custom siRNA library targeting 25 ESCRT-related factors and consisting of three different siRNAs per target gene was used to rule out the off-target effect (Silencer Select predesigned siRNA, Ambion). SK-N-SH cells were reverse-transfected with 20 nM of siRNA using Lipofectamine RNAiMAX (Invitrogen ...
-
bioRxiv - Immunology 2023Quote: siRNA for mouse Gpr109a (MSS234551), and control siRNA (Stealth RNAi Negative Universal Control, #12935) were purchased from Invitrogen (Carlsbad, CA). Ten microliters of 20 μM siRNA was introduced into BMMCs (5 × 106 ...
-
bioRxiv - Biophysics 2023Quote: ... Clathrin Heavy Chain siRNA (Human CLTC, sequence: GGUUGCUCUUGUUACG, ID: s475) and Negative Control#1 siRNA Silencer Select were purchased from ThermoFisher Scientific.
-
bioRxiv - Neuroscience 2023Quote: ... The following siRNAs were used for knockdown of adult rat-derived hippocampal NSCs: Stealth RNAi™ siRNA Derl1-MSS289837 (Invitrogen), Stealth RNAi™ siRNA Stat5b-RSS332572 (Invitrogen) ...
-
bioRxiv - Pathology 2023Quote: ... The Smn and scrambled siRNAs were aliquoted separately into an siRNA-lipofectamine complex containing Lipofectamine® RNAiMAX Reagent (#13778075, Invitrogen) and Opti-MEM (#31985062 ...
-
bioRxiv - Cancer Biology 2023Quote: ... siRNA or control non-targeting siRNA (Horizon Discovery cat#D-001810-10) were utilized with Lipofectamine RNAiMAX transfection reagent (Invitrogen). Transfections were carried out 20 nM siRNA following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: Human islets were transfected with 60 nM siRNA targeting human CEBPG (s2901, Silencer Select Pre-designed siRNA, Ambion, Life Technologies), TMEM176A (s226845 ...
-
bioRxiv - Cell Biology 2023Quote: Human islets were transfected with 60 nM siRNA targeting human CEBPG (s2901, Silencer Select Pre-designed siRNA, Ambion, Life Technologies), TMEM176A (s226845 ...
-
bioRxiv - Cell Biology 2023Quote: ... 15,000 cells were reverse-transfected with 0.3μl of Lipofectamine RNAiMax complex containing either 1 pico mol Silencer siRNA targeting or control non-targeting siRNA (Invitrogen 4390843). Media was exchanged 24 hours later and gene expression was assessed beginning 48 hours later in flow cytometry time courses or used as an endpoint for western blots ...
-
bioRxiv - Physiology 2024Quote: Knockdown of 14-3-3ζ was performed by transfecting cells with siRNA against Ywhaz (siYwhaz, 25 µM per well, s76189, Silencer Select siRNA, Ambion) or an equivalent concentration of a scrambled control siRNA (#4390844 ...
-
bioRxiv - Cell Biology 2023Quote: ... we used mouse BCAR1 siRNA (12927; ON-TARGETplus, SMARTpool, L-041961-00-0005, Horizon Discovery/ Dharmacon) or scrambled control siRNA (AM4636; Ambion). Knockdown efficiency and p130Cas over-expression levels were confirmed by Western blotting of cell lysates in radioimmunoprecipitation assay (RIPA ...
-
bioRxiv - Neuroscience 2024Quote: Plate-attached NSCs were transfected with 10μM of siRNA pools (ON-TARGETplus siRNA-SMARTpool, Dharmacon) using the RNAiMax system (Invitrogen, #13778100). The siRNA pools used were ...
-
bioRxiv - Pathology 2024Quote: ... scrambled siRNA or FOXN3 siRNA (10 nM) was transfected into the cells using Lipofectamine RNAiMAX Reagent (13778150, Thermo Fisher Scientific) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: HUVEC were grown to sub-confluency and treated with siRNAs (Key Resources Table, siRNA information) diluted in OptiMem (Gibco, #11058021) and Lipofectamine 3000 (ThermoFisher ...
-
bioRxiv - Biochemistry 2024Quote: All siRNAs (siControl: Stealth RNAiTM siRNA Negative Control, Med GC, siMat2a #911: MSS232488) were obtained from Invitrogen (Carlsbad, CA, USA). The target sequence of the siMat2a (911 ...
-
bioRxiv - Genomics 2024Quote: SW480 cells were transfected with 100 nM non-targeting siRNA control (Ctrl) or TOP1 siRNA duplexes listed in Table S7 (Dharmacon) using Lipofectamine 3000 (Invitrogen) according to the manufacturer’s directions (Life Technologies) ...
-
bioRxiv - Microbiology 2024Quote: ... GFPMTS and GFP-ScaCMTS cells were transfected with 10 nM of either a non-targeting (scrambled) siRNA (Silencer Select Negative Control #1 siRNA, Invitrogen) or siRNAs directed against BICD1 (Invitrogen ...
-
bioRxiv - Cancer Biology 2021Quote: ... or ABCE1 siRNAs diluted in OptiMEM (Thermofisher, 31985070) were transfected in triplicates in 48-well plates with Lipofectamine RNAiMAX (Thermofisher ...
-
bioRxiv - Cancer Biology 2021Quote: ... Forward transfection of p73 siRNA (s14319, Ambion®) was performed using the Lipofectamine® RNAiMAX Transfection Reagent (Life Technologies ...
-
bioRxiv - Cell Biology 2020Quote: ... and the siRNA was prepared in OptiMEM (Invitrogen), and incubated for 25 min at RT before addition to the cells ...
-
bioRxiv - Cell Biology 2020Quote: Protein depletion was achieved using Stealth siRNAs (Invitrogen). The following oligos were used ...
-
bioRxiv - Cell Biology 2020Quote: ... Transfection of siRNA was performed using RNAiMAX (Invitrogen) and cells were assayed 96 h post-transfection ...
-
bioRxiv - Cell Biology 2019Quote: ... selected with SVM siRNA Design Tool (Applied Biosystems) software and synthetized by Thermo Fischer Scientific ...
-
bioRxiv - Cell Biology 2020Quote: ... siRNA transfections were performed using Lipofectamine (Thermo Fisher) according to manufacturers’ instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... All siRNAs and shRNAs were from Thermo Fisher Scientific (Carlsbad ...
-
bioRxiv - Molecular Biology 2021Quote: ... and Silencer Select siRNA (s234520; Life Technologies Inc.) for Rplp1 gene knockdown were used in AML12 cells ...
-
bioRxiv - Molecular Biology 2021Quote: For siRNA transfections Lipofectamine RNAiMax (Invitrogen, Karlsruhe, Germany) was used ...
-
A human cancer cell line initiates DNA replication normally in the absence of ORC5 and ORC2 proteinsbioRxiv - Molecular Biology 2020Quote: ... CDC6 siRNA (GAUCGACUUAAUCAGGUAU) was synthesized by Thermo Fisher Scientific ...
-
A human cancer cell line initiates DNA replication normally in the absence of ORC5 and ORC2 proteinsbioRxiv - Molecular Biology 2020Quote: ... and siRNAs transfected with RNAiMAX (Thermo Fisher Scientific) according to the manufacturers” protocol ...
-
bioRxiv - Cell Biology 2022Quote: siRNA transfections were performed using Lipofectamine RNAiMAX (Invitrogen) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... Negative control siRNA (12,935–300) was from Invitrogen. Plasmid transfection was performed using TurboFect (Fisher ...