Labshake search
Citations for Thermo Fisher :
301 - 350 of 10000+ citations for Human KRT12 shRNA Plasmid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2019Quote: ... shCyb5r3 adenovirus was generated by cloning the effective shRNA sequence (5’-GATTGGAGACACCATTGAAT-3’) into the pEQU6-vector with LR Clonase II (ThermoFisher 11791100), then ligating to pAd-REP ...
-
bioRxiv - Bioengineering 2020Quote: ... Knockdown efficiency in the T cells following shRNA transduction was determined by real-time quantitative PCR with TaqMan gene expression assays (Applied Biosystems) for TET2 (assay Hs00325999_m1 ...
-
bioRxiv - Cancer Biology 2021Quote: ... and incubated for 15-40 min before adding MYCN-amplified IMR5/75 cells stably expressing a doxycycline-regulable MYCN shRNA (2,100 cells/well) using a Multidrop dispenser (Thermo Fisher Scientific). Two treatment conditions were screened in triplicate ...
-
bioRxiv - Biochemistry 2022Quote: ... an shRNA-generating sequence equivalent to the above siRNA sequence was inserted into the pSilencer 4.1 CMV-Hygro vector (Ambion, Austin TX). The plasmid was transfected into Neuro2a cells and clonal lines selected by incubation with Hygromycin (300 mg/ml ...
-
bioRxiv - Cancer Biology 2022Quote: ... Sequencing libraries were prepared by subjecting 18 μg (1.2 μg x 15 reactions) of genomic DNA (∼1000x shRNA representation) to PCR based barcoding and amplification with AmpliTaq Gold PCR kit (ThermoFisher Scientific). See Supplementary Table 3 for list of barcode adaptor primers ...
-
bioRxiv - Cell Biology 2019Quote: ... Cells in quadruplicate wells were transfected with 2 μg DNA of either TMEM163-KD (knock-down) shRNA or TMEM163-OE (over-expression) construct using TurboFect lipid reagent (Thermo Scientific). Twenty-four hours post-transfection ...
-
bioRxiv - Developmental Biology 2022Quote: Animals injected with either shRNA #1 or #2 were collected at 48hpf and lysed in 500 µl of TRIzolTM reagent (Invitrogen, 15596026) by vortexing extensively ...
-
bioRxiv - Cancer Biology 2023Quote: ... Zbtb46 knockdown MCEC and 1956 cell lines were generated by transducing the parental MCEC and 1956 cells with lentiviral particles from a set of 5 shRNA clones for Zbtb46 followed by puromycin selection (Cat: A1113802, ThermoFisher Scientific). GFP expressing Lewis lung carcinoma (LLC cells ...
-
bioRxiv - Cell Biology 2023Quote: ... 1.2 × 106 cells were transfected with 1 μg DNA or shRNA for each construct using the Neon transfection system (Life Technologies) following the manufacturer’s instructions (1200 pulse voltage ...
-
bioRxiv - Neuroscience 2024Quote: ... The specific miRNA-based shRNA against the mouse open reading frame (ORF) for MSK1 were generated using the BLOCK-iT™ RNAi Designer software (Invitrogen) and cloned into the pcDNA6.2-GW/miR vector according to instructions provided by the manufacturer ...
-
bioRxiv - Cell Biology 2021Quote: Primary human vein endothelial cells (HUVECs) were cultured in human endothelial SFM medium (Invitrogen) containing 20% foetal bovine serum ...
-
bioRxiv - Cell Biology 2020Quote: ... Human CD4+ T cells were activated by Dynabeads Human T-Activator CD3/CD28 (ThermoFisher) and cultured in AIMV medium (ThermoFisher ...
-
bioRxiv - Developmental Biology 2021Quote: ... transfection with TOL2-GFP-T2A-TGIF1 overexpression plasmid or control plasmid and transposase expressing plasmid was performed following the Lipofectamine 2000 protocol (Life Technologies). Cells were collected 48 hours post transfection and Trizol RNA extraction was performed as described before.
-
bioRxiv - Bioengineering 2021Quote: ... + 2% human serum albumin (ThermoFisher) + 5 μM ROCKi (Tocris) ...
-
bioRxiv - Cell Biology 2020Quote: ... Human GR-specific siRNA (Invitrogen) was used at a concentration of 100 nM for 48 h to effectively knock down GR ...
-
bioRxiv - Cancer Biology 2020Quote: ... Human primary melanocytes (Life Technologies) were grown in Medium 254 (Gibco ...
-
bioRxiv - Microbiology 2019Quote: ... including human 293FT cells (Invitrogen), rat2 cells (ATCC #CRL-1764) ...
-
bioRxiv - Physiology 2019Quote: ... human GDF15 (Hs00171132_m1 - ThermoFisher Scientific), human GAPDH (Hs02758991_g1 – ThermoFisher Scientific) ...
-
bioRxiv - Physiology 2019Quote: ... human GAPDH (Hs02758991_g1 – ThermoFisher Scientific), mouse HPRT (Forward – AGCCTAAGATGAGCGCAAGT ...
-
bioRxiv - Genetics 2019Quote: ... human COT-1 DNA (Invitrogen) and biotin-labeled mouse COT-1 or minor satellite DNA (a gift from Dr ...
-
bioRxiv - Genetics 2021Quote: ... human COT-1 DNA (ThermoFisher) to detect HSA21 and biotin-labeled I-EGFP-I-loxP-3’HPRT (ThermoFisher ...
-
bioRxiv - Bioengineering 2021Quote: ... recombinant human Vitronectin (Gibco A14700) was used at a final concentration of 25ug/ml ...
-
bioRxiv - Cancer Biology 2020Quote: Human recombinant IL-1β (ThermoFisher) was reconstituted in deionised water and administered at 10 ng/ml.
-
bioRxiv - Cell Biology 2021Quote: ... human FMR1 (Ambion, USA, 4392420) and human ATF4 (Ambion ...
-
bioRxiv - Molecular Biology 2022Quote: ... AlexaFluor633 anti-human (all ThermoFisher) used 1:2000 in PBS with 0.2% BSA ...
-
bioRxiv - Cancer Biology 2022Quote: ... Human CD11b-APC (Thermo Fisher); Human CD34-PE (Miltenyi Biotec);and Human CD33-APC-Cy7 (Abcam).
-
bioRxiv - Microbiology 2020Quote: ... and anti-human SPIB (Invitrogen) antibodies by incubating for 45 minutes at 4°C ...
-
bioRxiv - Cell Biology 2022Quote: Human epidermal keratinocytes (HEKs, Thermofisher), and patient keratinocytes ...
-
bioRxiv - Cancer Biology 2019Quote: ... Human Epidermal Melanocyte cells (Invitrogen) were cultured in Medium 254 (Invirogen ...
-
bioRxiv - Developmental Biology 2019Quote: ... and recombinant human FGF2 (Invitrogen) at 20 ng/ml ...
-
bioRxiv - Immunology 2021Quote: Human iPS cells (Thermo Fisher) were cultured on vitronectin-coated T225cm2 flasks using complete mTesSR Plus medium (StemCell Technologies ...
-
bioRxiv - Cancer Biology 2021Quote: ... human COT1 DNA (Invitrogen, 15279011) and Vysis CEP hybridization buffer (Abbott Molecular ...
-
bioRxiv - Immunology 2020Quote: ... Human Expi293 cells (Thermo Scientific) were transfected with these constructs using FectoPro (PolyPlus Transfection ...
-
bioRxiv - Neuroscience 2021Quote: Human iPSCs (Thermo Fisher #A18945) were maintained in mTeSR1 medium (StemCell ...
-
bioRxiv - Immunology 2022Quote: ... APRIL Human ELISA Kit (ThermoFisher) and Human CD83 DuoSet ELISA Kit (R&D systems) ...
-
bioRxiv - Neuroscience 2022Quote: ... and human ACTB (Thermofisher Hs01060665_g1). For other qPCRs ...
-
bioRxiv - Microbiology 2023Quote: ... human Gas6 (Invitrogen, cat# BMS2291), mouse Axl (Abcam ...
-
bioRxiv - Neuroscience 2022Quote: ... Human primary astrocytes (ThermoFisher #N7805200) were maintained as described in user manual ...
-
bioRxiv - Cancer Biology 2023Quote: ... anti-human CD235a (#17998742, Invitrogen), anti-human CD326 (EpCAM ...
-
bioRxiv - Cancer Biology 2023Quote: ... anti-human CD45 (#17945942, Invitrogen), anti-human CD235a (#17998742 ...
-
bioRxiv - Genomics 2023Quote: ... human p53 (Invitrogen, PA5-27822), MDM2 (Santa Cruz Biotechnology ...
-
bioRxiv - Systems Biology 2023Quote: ... and human IgE-PE (ThermoFisher). Antibody details are shown in Table S4 ...
-
bioRxiv - Cancer Biology 2023Quote: ... human IFN-gamma ELISA (Invitrogen) and granzyme B ELISA (R&D Systems ...
-
bioRxiv - Physiology 2023Quote: ... Human GR-specific siRNA (Invitrogen) was used at a concentration of 100 nM for 48 h to effectively knockdown GR ...
-
bioRxiv - Cell Biology 2023Quote: ... Human Cot-1 DNA (Invitrogen), 3M NaAc and 100% cold EtOH ...
-
bioRxiv - Molecular Biology 2024Quote: ... human COT1 DNA (#15279011, Invitrogen) and 3 volumes of ethanol (#10000652 ...
-
bioRxiv - Immunology 2024Quote: ... or anti-human (Invitrogen #A11013) secondary antibodies at 20 μg/mL in PBS/2% BSA for 30 min ...
-
bioRxiv - Microbiology 2022Quote: ... Plasmids for transfection were purified using PureLink™ HiPure Plasmid Midiprep Kit (Invitrogen).
-
bioRxiv - Genetics 2019Quote: ... The plasmid library was purified with a GeneJET Plasmid Midiprep Kit (Thermo Scientific).
-
bioRxiv - Genomics 2020Quote: ... Bacteria were harvested and plasmids isolated using GeneJet Plasmid Miniprep kit (Thermo Scientific). PCR was performed to evaluate clone inserts ...