Labshake search
Citations for Thermo Fisher :
101 - 150 of 10000+ citations for Dengue Virus Serotype 3 Envelope Protein Insect Cells since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2021Quote: ... Baculoviruses were generated and amplified in Sf9 insect cells (Thermo Fisher Scientific) using the EMBacY baculoviral genome (66) ...
-
bioRxiv - Molecular Biology 2023Quote: The NCBP1-NCBP2 complex was expressed in High-Five insect cells (Invitrogen) by coinfection of recombinant baculoviruses ...
-
bioRxiv - Microbiology 2024Quote: ... was synthesized by Genscript and cloned into a modified pMT/BiP insect cell expression plasmid (Invitrogen) designated pT350 ...
-
bioRxiv - Immunology 2020Quote: ... and reverse primer ENVN (5’ - TGCCAATCAGGGAAAAAGCCTTGTGTG - 3’. The envelope amplicons were purified, and ligated into pcDNA3.1D/V5-His-TOPO vector (Invitrogen). Chimeric envelope pseudoviruses were generated by swapping the V1V2 ...
-
bioRxiv - Immunology 2019Quote: ... 3 μg guide RNA plasmid was cotranfected into 5 × 106 HEK293T cells with 3 μmg psPAX2 packaging vector and 1.5 μg pMD2.G VSV-G envelope vector using lipofectamine 2000 (Invitrogen). Supernatants were harvested over 72 hours ...
-
bioRxiv - Biochemistry 2021Quote: ... minus the 21 C-terminus residues was used as a starting material for protein expression in insect cells (Sf9, Invitrogen, Burlington, ON, Canada). We employed the MultiBac (Geneva Biotech ...
-
bioRxiv - Cell Biology 2019Quote: The human dynein complex was expressed and purified from insect cells (ExpiSf9 cells; Life Technologies) as previously described with minor modifications72 ...
-
bioRxiv - Molecular Biology 2019Quote: ... Cells were cultured at 27°C in ESF 921 insect cell culture medium (Fisher Scientific), pelleted at 1,000xg for 15 min ...
-
bioRxiv - Cell Biology 2019Quote: ... the human dynein complex was expressed and purified from insect cells (ExpiSf9 cells; Life Technologies) as previously described with minor modifications1 ...
-
bioRxiv - Microbiology 2023Quote: Aedes albopictus C6/36 cells were grown in Schneiders insect cell culture medium (Gibco; 21720024) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Immunology 2021Quote: ... The lentiviral envelope vector pLP/VSVG (Invitrogen) and the packaging vector psPAX2 (Trono lab ...
-
bioRxiv - Molecular Biology 2020Quote: ... and envelope plasmid in OptiMEM (Life Technologies) for 5 to 6 hours (PEI:total pDNA μg ratio 2:1) ...
-
bioRxiv - Microbiology 2022Quote: ... and the concentration of total virus proteins were determined by a BCA protein assay kit (Thermo Fisher) (31 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Vesicular stomatitis virus glycoprotein-pseudotyped virus was produced by co-transfecting 293T cells using Lipofectamine 2000 (Invitrogen) with an shRNA transducing vector and 2 packaging vectors ...
-
bioRxiv - Microbiology 2022Quote: ... Cell envelope samples were vitrified using a Vitrobot plunge-freezing machine (Mark IV, ThermoFisher) at room temperature (blot force 2 ...
-
bioRxiv - Molecular Biology 2020Quote: ... the cell envelope was stained with wheat germ agglutinin-AlexaFluor488 (WGA-AF488, Life Technologies), which was added to the loading well to a final concentration of 10 μg/mL prior to loading cells into the imaging chamber ...
-
bioRxiv - Immunology 2022Quote: CH848 SOSIP gp140 envelope production was performed with Freestyle293 cells (ThermoFisher Cat No. R79007). On the day of transfection ...
-
bioRxiv - Microbiology 2020Quote: The purified JEV structural proteins (C, M, E, ED III) from the S2 insect expression system (Invitrogen) were quantified by using the bicinchoninic acid (BCA ...
-
bioRxiv - Immunology 2021Quote: ... 293GP cells were then transfected with 6 μg of a candidate TCR pMSGV1-plasmid in the presence of the 3 μg of RD114 envelope using Lipofectamine 3000 (Invitrogen). The pMSGV1-plasmid and RD114 were obtained through an MTA from S ...
-
bioRxiv - Cancer Biology 2024Quote: ... shRNA plasmids were cotransfected with the packaging and envelope plasmids using Lipofectamine 3000 at a ratio of 4:3:1 (#L3000001, Thermofisher) into LentiX cells ...
-
bioRxiv - Cell Biology 2020Quote: ... Sf9 cells were cultured in flasks with Lonza Insect Xpress medium (Fisher Scientific) containing 10% heat inactivated FBS ...
-
bioRxiv - Biochemistry 2020Quote: ... The resulting bacmids were transfected into Sf9 insect cells using cellfectin II (Gibco). Virus was harvested after 3 days and used to further amplify the viral concentration in a larger Sf9 cell culture ...
-
bioRxiv - Plant Biology 2021Quote: ... The constructs were used for generating recombinant baculovirus in Sf21 insect cells (Invitrogen). RBA1 and RBA1 mutant proteins were expressed in Sf21 insect cells with recombinant baculovirus infection at 28 °C for 48 hr ...
-
bioRxiv - Immunology 2021Quote: Insect expression DNA constructs were transfected into Trichoplusia ni (High Five) cells (Invitrogen) using the BaculoGold baculovirus expression system (BD Biosciences ...
-
bioRxiv - Genomics 2023Quote: Drosophila Kc167 cells grown to log phase in HYQ-SFX Insect medium (Invitrogen) supplemented with 18 mM L-Glutamine and harvested as previously described (28) ...
-
bioRxiv - Biochemistry 2023Quote: ... FZD3 and FZD6 were expressed in Spodoptera frugiperda Sf9 insect cells (Thermo Fisher) using the baculovirus method (Expression Systems) ...
-
bioRxiv - Molecular Biology 2023Quote: BmN4 cells were cultured at 27°C in IPL-41 insect medium (Gibco) supplemented with 10% FBS and 0.5% Pen-Strep (Gibco) ...
-
bioRxiv - Biochemistry 2023Quote: The G11 heterotrimer was expressed in High Five insect cells (Invitrogen, Waltham, USA) by co-infection with a virus encoding for all three subunits and a virus encoding for GST-Ric8A ...
-
bioRxiv - Immunology 2022Quote: ... or mouse anti-Hepatitis C virus Core protein (clone C7-50, Life Technologies) were visualised using IRDye 800CW Donkey anti-Rabbit IgG or Goat anti-Mouse IgG (LiCor) ...
-
bioRxiv - Immunology 2021Quote: ... Virus was titrated by adding serial dilutions of virus supernatant (8 replicates) on VeroE6 cells in DMEM (Gibco) containing 2% FBS ...
-
bioRxiv - Microbiology 2020Quote: Virus stocks were prepared by transfecting 293FT cells (Invitrogen) seeded in 10 cm cell culture dishes with the viral constructs described above ...
-
bioRxiv - Molecular Biology 2020Quote: Collected insects were submitted to single insect RNA extractions using TRIzol reagent (Life Technologies, Carlsbad, CA, USA), treated with RQ1 RNase-free DNase I (Promega ...
-
bioRxiv - Microbiology 2022Quote: ... The protein concentration of the purified virus preparations was determined using a BCA protein assay kit (Thermo Fisher Scientific) prior to the addition of lysis buffer ...
-
bioRxiv - Biochemistry 2020Quote: ... All insect cell lines used for expression were purchased from Life Technologies (Sf9, Sf21) or from Expression Systems (Hi5 ...
-
bioRxiv - Biophysics 2021Quote: MAP4 was expressed in insect cells using the Bac-to-Bac system (Thermo Fisher). Cells were infected at ∼2 million cells/ml for 60 hours before harvesting ...
-
bioRxiv - Neuroscience 2020Quote: ... isolated dissected brains were briefly stored in Schneider’s insect cell medium (Life Technologies, A820) supplemented with 5% heat-inactivated fetal bovine serum (FBS ...
-
bioRxiv - Microbiology 2022Quote: Sf21 insect cells cultured in suspension in SF-900 II serum free medium (Invitrogen) were infected with recombinant baculovirus expressing either wt or mutant RSV or MARV L protein together with either RSV P or MARV VP35 containing a C-terminal histidine tag ...
-
bioRxiv - Biochemistry 2020Quote: ... Insect cells were cultured in Sf-900 III SFM medium (Thermo Fisher, Cat#12658019).
-
bioRxiv - Biochemistry 2021Quote: ... and the resulting bacmid DNA was transfected into Sf9 insect cells via CellFECTIN (ThermoFisher). Sf9 cells were grown in Sf-900 II SFM media (Gibco ...
-
bioRxiv - Microbiology 2020Quote: 6xHis-OCRL was prepared from Sf9 insect cells using a baculovirus expression system (Invitrogen) according to the manufacturer’s specification ...
-
bioRxiv - Zoology 2024Quote: ... Insect cells medium was also supplemented with 1 % non-essential amino acid (Gibco, France). Mosquito cells were grown at 28°C and mammalian cells at 37°C ...
-
bioRxiv - Cell Biology 2023Quote: ... we purified bacmid DNA for transfection into Sf9 insect cells (12659017, Thermo Fisher, RRID:CVCL_0549). To this end ...
-
bioRxiv - Cell Biology 2023Quote: ... after which High Five insect cells (BTI-TN-5B1-4; B85502; Thermo Fisher Scientific) were transfected with the bacmid DNAs using Cellfectin II (10362100 ...
-
bioRxiv - Cancer Biology 2022Quote: ... the VSV-G envelope protein vector pMD2.G and the respective pGIPZ-shRNA-target plasmid using lipofectamine 3000 (Invitrogen #L3000008). Filtered virus supernatant was used to transduce MDA-MB-468 and 4T1 cells in DMEM supplemented with 2% FBS ...
-
bioRxiv - Microbiology 2021Quote: ... Insect Sf9 (Spodoptera frugiperda) (ThermoFisher Scientific; 11496015) cells were cultured in Sf-900 II serum free medium (ThermoFisher Scientific ...
-
bioRxiv - Immunology 2020Quote: ... Grace’s insect medium was purchased from Gibco. The Immun Star HRP substrate kit was from Bio-Rad Laboratories Inc ...
-
bioRxiv - Molecular Biology 2023Quote: ... and virus amplification in Spodopetera frugiperda 9 (Sf9) cells (ThermoFisher) was performed using standard procedures and as described in Zeqiraj et al ...
-
bioRxiv - Immunology 2021Quote: 293T cells were transfected with full-length envelope expressing plasmid using lipofectamine2000 (ThermoFisher, catalog no 11668027) as per the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2019Quote: ... and the lentiviral envelope vector VSVg were transfected into HEK 293T cells with TurboFect (Life Technologies). Transfected HEK 293T cells were incubated for two days before the virus-laden medium was transferred to HMECs or K562 cells ...
-
bioRxiv - Biophysics 2023Quote: ... and a BG505 envelope SOSIP were expressed in FreestyleTM 293-F cells (ThermoFisher Cat No. R79007). Before transfection ...