Labshake search
Citations for Thermo Fisher :
51 - 100 of 10000+ citations for Chemokine C X C Motif Ligand 3 CXCL3 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... antibodies overnight at 4°C and then incubated for an additional 3 hours at 4°C with 50 μL DynabeadsTM protein G (Life Technologies, 10004D). Following three washes with 1% Triton-TBS lysis buffer ...
-
bioRxiv - Bioengineering 2019Quote: ... followed by 40 cycles at 95° C for 3 s and 60° C for 20 s (7500 Fast Real-Time PCR System; Thermo Fisher Scientific). Taqman probes for Gnat1 (Mm01229120 ...
-
bioRxiv - Immunology 2023Quote: ... followed by 40 cycles at 95°C for 15 sec then 60°C for 1 min using a QuantStudio 3 Real-Time PCR System (Thermo Fisher Scientific). Extracted MAC DNA was used as the quantification standard.
-
bioRxiv - Biochemistry 2021Quote: ... and ligands were diluted to appropriate concentrations (5 x final concentration) in HBSS (Thermofisher) supplemented with 20 mM HEPES (Sigma) ...
-
bioRxiv - Molecular Biology 2021Quote: ... COCS were incubated for 3 days at 4°C with secondary antibodies Alexa594-conjugated goat anti-rabbit IgG (Life Technologies) or Alexa647-conjugated goat anti-rat IgG (Life Technologies ...
-
bioRxiv - Neuroscience 2022Quote: ... brain slices were washed (5 min at RT x 3 times) in PBS and incubated (overnight at 4°C) with streptavidin-Alexa 488 (ThermoFisher Scientific, S-11223, 1:500) in PBS-triton 0.05% ...
-
bioRxiv - Microbiology 2020Quote: ... The samples were then centrifuged for 3 minutes at 10000 RPM and heated for 10 minutes at 100°C in an Eppendorf Thermomixer C (Thermo Fisher Scientific, USA) to lyse the bacterial cells ...
-
bioRxiv - Genomics 2023Quote: ... were thawed in a 37 °C water bath for 3 minutes and then mixed with 37 °C thawing media containing: RPMI Medium 1640 (Life Technologies #11875-085) supplemented with 5% heat-inactivated fetal bovine serum (Life Technologies #16000044) ...
-
bioRxiv - Bioengineering 2021Quote: ... The anti-His(C-term)-HRP antibody (R931-25, Invitrogen) was used ...
-
bioRxiv - Cancer Biology 2021Quote: ... Primary C-MYC tag antibody (PA1-981, Thermo Fisher Scientific) and N-MYC Polyclonal antibody (PA5-17403 ...
-
bioRxiv - Neuroscience 2020Quote: ... for 1 h at RT and then incubated for 3 days at 4°C with the monoclonal mouse anti-NeuN antibody conjugated with Alexa-488 (clone A60, Life Technologies) at a concentration of 0.5 µg mL-1 into blocking buffer ...
-
bioRxiv - Immunology 2022Quote: ... 700 μg of protein were mixed and rotated with 0.5 μg of STING antibody for 3 h at 4 °C after which 25 μL of Dynabeads Protein G (Invitrogen, 10004D) were added to each sample and rotated for an additional hour ...
-
bioRxiv - Developmental Biology 2022Quote: ... Table 2) incubated for 3 overnights at 4 °C in blocking buffer with Alexa-dye conjugated secondary antibodies (1:500, Molecular Probes) incubated for 1 overnight at 4 °C in blocking buffer ...
-
bioRxiv - Neuroscience 2020Quote: ... Cells were then incubated with primary antibodies in 10% NGS/NDS in PBST over night at 4°C following 1h incubation at 24°C with appropriate Alexa488/568 coupled secondary antibodies (1:1000, Invitrogen). Cell nuclei were stained with DAPI and final images were acquired using Leica TCS SP8 confocal microscope (Leica Microsystems ...
-
bioRxiv - Cell Biology 2021Quote: WBM cells were incubated for 30 minutes at 4°C with antibodies for HSC isolation (CD34, CD48, Sca, c-Kit; Invitrogen), lineage markers (CD3e ...
-
bioRxiv - Biochemistry 2021Quote: ... and an Acclaim PepMap C-18 column (50 cm x 75 μm, Thermo Fisher Scientific) coupled to a Q Exactive HF-X hybrid quadrupole-Orbitrap mass spectrometer (Thermo Fisher Scientific) ...
-
bioRxiv - Immunology 2020Quote: ... 000 x g at 4°C and protein concentration measured using Pierce BCA (Thermo Fisher). Equivalent amount of protein in each sample were immunoprecipitated by rotating with 0.25-1 µg of FADD antibody (M19 ...
-
bioRxiv - Immunology 2020Quote: PBMCs were incubated overnight (37°C, 5% CO2) in X-vivo 15 media (Fisher Scientific) supplemented with 5% AB Serum (Invitrogen ...
-
bioRxiv - Cancer Biology 2021Quote: ... sections were incubated overnight at 4 °C with ~100ul primary antibodies diluted in 1% BSA+Triton-X (Thermo Fisher Scientific, Rockford, IL, USA) [1] ...
-
bioRxiv - Biochemistry 2023Quote: ... they were fixed with 3.7% formaldehyde followed by 0.1% Triton X-100 permeabilisation (Pudełek et al., 2020) and non-specific binding sites were blocked with 3% BSA (Invitrogen, No. 37525; 30 min. in 37°C). After washing with 2% PBS ...
-
bioRxiv - Biochemistry 2023Quote: ... and the antibody was c-Myc monoclonal antibody 9E10 (Life Technologies, catalog number 132500).
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were washed with PBS and incubated overnight at 4°C with primary antibody solution: Antibody in IF buffer containing 3% Saponin (Fisher Scientific, Cat. No. 55-825-5100GM). Antibodies used were as follows ...
-
bioRxiv - Microbiology 2022Quote: ... anti-c-Myc mouse monoclonal antibody (1:1000, Thermo Fisher, 9E10), anti-P66 rabbit polyclonal antibody (1:100 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Anti-c-Myc (9E10) epitope tag monoclonal antibody was from Invitrogen. Benzonase® nuclease was from Novagen (EMD Millipore ...
-
bioRxiv - Physiology 2023Quote: ... and probed with antibodies against C/EBPβ (Thermo Fisher, MA1-827), BCKDHA (Thermo Fisher ...
-
bioRxiv - Physiology 2024Quote: ... were incubated overnight at 4°C and the secondary antibodies (Invitrogen) were incubated for 1 h at room temperature.
-
bioRxiv - Cell Biology 2024Quote: ... for overnight at 4°C and Alexa-labeled secondary antibodies (Invitrogen, A11006 ...
-
bioRxiv - Cell Biology 2022Quote: MUTZ-3 cells (DSMZ) were cultured at 37°C in alpha-MEM (Life Technologies) supplemented with 20% FBS ...
-
bioRxiv - Microbiology 2020Quote: ... 3 μg of mammalian expression vector plasmids based on pEF1α V5 His C (Invitrogen) encoding codon-optimized gH ...
-
bioRxiv - Neuroscience 2020Quote: ... and probed overnight at 4°C with the following primary antibodies diluted in 1x TBS-T with 3% BSA (Fisher Scientific, BP1600): α-CD11b (1:1000 ...
-
bioRxiv - Microbiology 2020Quote: ... Pre-cleared lysates were further incubated at 4°C overnight with the indicated antibodies (1 to 3 μl) and protein A agarose or protein G Dynabeads (Thermo Fisher Scientific). Immunoprecipitates were washed three times with RIPA buffer (LSB ...
-
bioRxiv - Neuroscience 2024Quote: ... and probed overnight at 4°C with the following primary antibodies diluted in 1x TBS-T with 3% BSA (Fisher Scientific BP1600): α-SARM1 (BioLegend 696602 ...
-
bioRxiv - Systems Biology 2020Quote: ... and then 40 cycles of 95°C for 1 s and 60°C for 30 s in QuantStudio 3 Real-Time PCR System (Applied Biosystems, Foster City, CA, USA). PCR primers were designed using the Primer-BLAST tool available from the NCBI web site (57) ...
-
bioRxiv - Microbiology 2021Quote: ... then 40 cycles of 94°C for 1 minute and 60°C for 1 minute on a QuantStudio 3 real-time thermocycler (Thermo Fisher Scientific, Waltham, MA, USA). KPPR1 genomic DNA was used as positive control and 100% reference for calculating Klebsiella relative abundances ...
-
bioRxiv - Cell Biology 2024Quote: ... cells were incubated overnight at 37°C in X-gal staining solution (1mg/ml X-gal [Thermo Fisher], 0.12 mM K3Fe(CN)6 [Merk] ...
-
bioRxiv - Cell Biology 2020Quote: ... centrifuged (0.8 or 1 x 103 G, 10 min, 20 °C, Fisher Scientific AccuSpin Micro 17R) to remove access dye and kept at 37 °C until use ...
-
bioRxiv - Immunology 2022Quote: ... The analytical column RSLC PepMan C-18 (Thermo Fisher Scientific, 2uM, 100Å, 75μm id x 50cm) was used at 55°C to analyze the samples with the mobile phase of buffer A (0.1% formic acid in MS grade water ...
-
bioRxiv - Biochemistry 2023Quote: P.pastoris strain X-33 and the vector pPICZα C were purchased from Invitrogen (Thermo Fisher Scientific). E.coli XL-10 cells were provided by STRATAGENE EUROPE.
-
bioRxiv - Cell Biology 2020Quote: ... thermoblocks at 90°C and 50°C (e.g., Thermo Fisher, 88870004), an ultracentrifuge capable of spinning 50 ml falcon tubes at 10,000 rpm (Beckman Coulter Avanti J-30 I ultracentrifuge and a Beckman JA-12 fixed angle rotor) ...
-
bioRxiv - Neuroscience 2024Quote: ... Fast SYBR™C Green Master Mix (Applied Biosystems™C) was employed along with primers at a concentration of 5nM ...
-
bioRxiv - Neuroscience 2021Quote: ... the membranes were probed with the following primary antibodies at 4°C overnight: mouse anti-EphA4 C-terminus (Invitrogen, USA; 1:1000), goat anti-EphA4 N-terminus (R&D Systems ...
-
bioRxiv - Microbiology 2021Quote: ... followed by 30 minutes with 0.1% Tween/PBS at 37°C and 1 hour at 37°C with secondary antibody Alexa-488 goat anti-mouse (1:500) (Life Technologies #A11029) in 1% BSA/PBS before mounting with Prolong Gold with DAPI (Invitrogen #P36935) ...
-
bioRxiv - Microbiology 2021Quote: ... denaturation for 2 min at 95 °C followed by 45 cycles of 3 s at 95 °C and 30 s 60 °C on the StepOnePlus™ Real-Time PCR System (Applied Biosystems, Foster City, CA, USA). All samples were run in triplicate ...
-
bioRxiv - Cancer Biology 2023Quote: ... and patient-derived cell cultures (P022.C, P024.C, P030.C) were cultured in Dulbecco’s modified Eagle medium (DMEM, #41966, Gibco) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Neuroscience 2022Quote: ... Primary antibodies were incubated overnight at 4°C and Alexa Fluor-conjugated secondary antibodies (Invitrogen) were incubated for 1 hour at RT ...
-
bioRxiv - Cell Biology 2022Quote: ... anti-guineapig CENP-C antibody (MBL) followed by Alexa Flour 647 anti-guineapig antibody (Invitrogen). All antibodies were diluted at 1:500 dilution rate.
-
bioRxiv - Cancer Biology 2021Quote: ... and an HA-tag was added by using AgeI-and NotI-restriction site containing primers (forward: 5’-ATTAACCGGTGCCACCATGCCCCAGCTCG-3’; revers: 5’-TAATGCGGCCGCTTAAGCGTAATCTGGAACATCGTAGTGGGCAGACTTGGTGACC −3’) and a final Tm of 65 °C (Phusion Polymerase, ThermoFisher), before cloning it into the multiple cloning site of a modified pTP vector47 ...
-
bioRxiv - Cell Biology 2021Quote: ... The Stim coding sequence was cloned by PCR using primers 5’-CAC CAT GCG AAA GAA TAC CAT TTG GAA C-3’ and 5’-TTC CGT GGC AAG CAG CGA AAA GTT C-3’ and ligated into pENTR/D-TOPO (Invitrogen). Site-directed mutagenesis (Stratagene QuikChange XL ...
-
bioRxiv - Microbiology 2019Quote: ... (Thermo Acclaim C30, 2.1 × 250 mm, 3 µm, operated at 50° C; Thermo Fisher Scientific) connected to an HP 1100 series HPLC (Agilent ...
-
bioRxiv - Cell Biology 2023Quote: ... digestion for 3 to 5 min at 37 °C and washed with Neurobasal medium (Invitrogen) supplemented with 2% B-27 (Invitrogen) ...