Labshake search
Citations for Thermo Fisher :
201 - 250 of 1451 citations for Beta glucuronidase GUSB E.coli His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... and 0.5% HI FBS (Gibco). Neutrophils were recovered from the bottom of the tube.
-
bioRxiv - Microbiology 2023Quote: ... GFP-His (Thermo Fisher # A42613), NL63 N-His (Sino Biological # 40641-V07E) ...
-
bioRxiv - Molecular Biology 2023Quote: ... His-bind magnetic Dynabeads (Invitrogen) were washed with TBS containing 0.05% Tween-20 (TBS-T ...
-
bioRxiv - Microbiology 2022Quote: ... and 0.5% HI FBS (Gibco).
-
bioRxiv - Molecular Biology 2023Quote: ... anti-His (ThermoFisher scientific, rd230540a), anti-SETD6 (Genetex ...
-
bioRxiv - Cancer Biology 2023Quote: ... with 2% HI FBS (Gibco) and 0.4% 0.5M EDTA (Invitrogen ...
-
bioRxiv - Microbiology 2024Quote: ... and 10% HI FBS (Gibco). Media were supplemented with interleukin-2 (IL-2 ...
-
bioRxiv - Molecular Biology 2020Quote: ... supernatants were diluted 4-fold and assayed with the Amyloid beta 40 Human ELISA Kit and either the Amyloid beta 42 Human ELISA Kit or the Amyloid beta 42 Human ELISA Kit Ultrasensitive (Invitrogen), according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2022Quote: ... benthamiana genome was fused upstream of the GUS (β-glucuronidase) reporter gene in pENTR vector (pENTR/D-TOPO Cloning Kit, Thermo Fisher Scientific, Waltham, USA) and transferred into the binary vector pGWB1 (Nakagawa et al. ...
-
bioRxiv - Cell Biology 2020Quote: ... Beta-2-Microglobulin-Mm00437762_m1 (Applied Biosystems, Waltham, MA). Gene expression levels were normalized to β-2-microglobulin ...
-
bioRxiv - Developmental Biology 2019Quote: ... 4ng/ml beta-FGF (Thermo Scientific®; RFGFB50), 50nM PMA (Sigma ...
-
bioRxiv - Bioengineering 2021Quote: ... or mouse monoclonal anti-beta tubulin (MA516308, Invitrogen) antibodies ...
-
bioRxiv - Microbiology 2022Quote: ... and Beta-Actin (Mm02619580_g1) were from Applied Biosystems. The following forward and reverse primers were used to amplify VSig4 - 5’ GGAGATCTCATCAGGCTTGC3’ and 5’CCAGGTCCCTGTCACACTCT ...
-
bioRxiv - Cell Biology 2022Quote: ... normalization using either beta-actin (Hs99999903_1, Applied Biosystems) or GAPDH (Hs03929097_g1 ...
-
bioRxiv - Molecular Biology 2021Quote: ... 0.1 mM beta-mercaptoethanol (Invitrogen, Cat# 31350-010), 2 mM L-glutamine (Invitrogen ...
-
bioRxiv - Neuroscience 2020Quote: ... Beta-actin (Catalog # MA5-11869, ThermoFisher Scientific Inc), VDAC1 (Catalog # ab 15895 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 0.1 mM Beta-Mercaptoethanol (Gibco, Cat. No. 31350010), 1000 units/mL LIF (Millipore ...
-
bioRxiv - Cell Biology 2019Quote: ... rabbit anti-Beta Galactosidase (1:1000, Life Technologies), mouse anti-Beta Galactosidase (1:1000 ...
-
bioRxiv - Genomics 2021Quote: ... 2 μl of beta-agarase (Thermo Fisher Scientific) were added for agarose digestion and the reaction was incubated at 43 °C for 45 min ...
-
bioRxiv - Developmental Biology 2022Quote: ... 0.1 mM Beta-mercaptoethanol (Fisher Scientific, #21985-023), Primocin (Fisher Scientific ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2% n-Dodecyl-beta-Maltoside Detergent (Thermo Scientific). For lysis tests ...
-
bioRxiv - Neuroscience 2023Quote: ... and 0.055 mM beta-mercaptoethanol (Thermo Fisher Scientific), with fresh medium added weekly ...
-
bioRxiv - Microbiology 2023Quote: ... and beta-actin (Thermo Fisher Scientific, MA5-15739). Fluorescent secondary antibodies were purchased from Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2023Quote: ... Human Beta-2-Microglobulin (B2M) (ThermoFisher, Cat# 4333766T) served as an endogenous control for RNA input ...
-
bioRxiv - Molecular Biology 2023Quote: ... and electroporated into MegaX 10 beta cells (Invitrogen). Transformations were recovered in 1mL of SOC for 1hr at 37°C ...
-
bioRxiv - Neuroscience 2024Quote: ... and 400 uL of beta-mercaptoethanol (Life Technologies).
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... 0.1% beta-Mercaptoethanol (2-Me; Gibco, Darmstadt, Germany) and 100 U/ml Penicillin and 100 μg/ml Streptomycin at 37 °C in a humidified environment at 5% CO2.
-
bioRxiv - Neuroscience 2021Quote: ... coli using a standard protocol (One Shot™ TOP10 Electrocomp™ E.coli, ThermoFisher scientific). The successful assembly of the insertion ...
-
bioRxiv - Neuroscience 2022Quote: To study phagocytosis we used red fluorescent pHrodo E.coli bioparticles (#P35361, Thermo Fisher Scientific) in the phagocytosis assay ...
-
bioRxiv - Cell Biology 2021Quote: ... Recombination reactions were transformed into One Shot Stbl3 Chemically Competent E.coli (Thermo Fisher, C737303).
-
bioRxiv - Cell Biology 2019Quote: ... GST-PI31 was expressed in BL21 Star (DE3) E.coli cells(Thermo Fisher Scientific, #C601003), and purified using Glutathione Sepharose 4B beads (GE Healthcare ...
-
bioRxiv - Immunology 2021Quote: ... Plasmids containing genes of interest were used to transform E.coli BL21 (DE3) Star (Invitrogen). Recombinant proteins were induced upon addition of 1mM IPTG in cultures containing kanamycin 50 μg/mL and incubated with agitation at 37 °C ...
-
bioRxiv - Molecular Biology 2022Quote: ... All the recombinant proteins were transformed and expressed in E.coli BL21 (DE3) (Invitrogen, USA).
-
bioRxiv - Biophysics 2024Quote: The DNA coding CryoR1-5 were optimized for E.coli using GeneArt (Thermo Fisher Scientific). Genes were synthesized commercially (Eurofins) ...
-
bioRxiv - Microbiology 2020Quote: rCEACAM-His was attached to nickel dynabeads (DB; Dynabead His-tag pull-down & isolation, Invitrogen) following standard protocols ...
-
bioRxiv - Plant Biology 2022Quote: ... His-tagged ChElp2 was pulled-down with Dynabeads™ His-Tag (Thermo Fisher Scientific, Massachusetts, USA) and the subsequent western blot analyses were performed with anti-His (Sigma ...
-
bioRxiv - Immunology 2024Quote: ... the lysate supernatant containing His-tagged proteins was affinity-purified with His-Tag magnetic beads (Invitrogen) and used for pull-down assays ...
-
bioRxiv - Molecular Biology 2021Quote: ... The TA cloning reaction was transformed into E.coli OneShot Top 10 competent cells (Thermo Fisher) and cells were spread onto LB agar supplemented with 100 µg/mL spectinomycin for selection of transformants ...
-
bioRxiv - Neuroscience 2020Quote: ... following manufacturer’s instructions and then transformed into OneShot Top10 E.coli (Thermo Fisher, cat. no. C404003). Positives clones were verified by sequencing ...
-
bioRxiv - Pathology 2021Quote: ... 100 µl cord blood was stimulated with pHrodo red-conjugated E.coli bioparticles (Phagocytosis kit, Thermofisher) at 37°C for 30 min ...
-
bioRxiv - Biochemistry 2023Quote: ... and - 2 for E.coli were prepared using Pierce HeLa Protein Digest Standard (Thermo Fisher Scientific), MS Compatible Yeast Protein Extract ...
-
bioRxiv - Biophysics 2023Quote: ErNaR coding DNA was optimized for E.coli or human codons using GeneArt (Thermo Fisher Scientific). Genes were synthesized commercially (Eurofins) ...
-
bioRxiv - Molecular Biology 2024Quote: The following constructs were expressed separately or together in E.coli BL21 Star (DE3) cells (Invitrogen): MBP/6xHis-GB1-hsINTS13 (VWA ...
-
bioRxiv - Microbiology 2020Quote: Dynabeads His-Tag Isolation & Pulldown (Invitrogen) were washed in PBS-TH (PBS ...
-
bioRxiv - Molecular Biology 2021Quote: ... anti-His (Thermo Fisher scientific, rd230540a), anti-EZH2 (Cell signaling #5246 ...
-
Map7D2 and Map7D1 facilitate microtubule stabilization through distinct mechanisms in neuronal cellsbioRxiv - Cell Biology 2022Quote: ... pcDNA3.1/V5-His (Thermo Fisher Scientific), pCLXSN-GFP (Reiley et al 2005) ...
-
bioRxiv - Cancer Biology 2020Quote: ... supplemented with 10% HI-FBS (Gibco) at 37°C in the presence of 5% CO2 ...
-
bioRxiv - Genetics 2019Quote: ... 2% HI horse serum (Thermo Fisher), and 1% P/S ...
-
bioRxiv - Immunology 2021Quote: ... magnetic beads (Dynabeads His-Tag, Invitrogen) were coated with histidine tagged S protein according to the manufacturers’ instructions ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Hi-Di Formamide (Applied Biosystems, California) and 500 liz size standard (Applied Biosystems ...