Labshake search
Citations for Thermo Fisher :
501 - 550 of 10000+ citations for 8 HYDROXY 1 3 DIOXOLO 4 5 G QUINOLINE 7 CARBOXYLIC ACID ETHYL ESTER since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... Homogenates were submitted to an SDS-PAGE protein separation in 4-12 % or 3-8 % (depending on the molecular weight of the protein of interest) NuPAGE bis-tris gels (Invitrogen) and transferred to a nitrocellulose membrane (Amersham) ...
-
bioRxiv - Cell Biology 2021Quote: ... and equal concentrations of each sample were separated on a 3-8% Tris-Acetate or 4-12% Bis-Tris gel (Invitrogen) by SDS-PAGE and transferred to a nitrocellulose membrane ...
-
bioRxiv - Systems Biology 2022Quote: ... Transcriptomics using the isolated mRNA from liver tissues (0, 2, 4, 6, 8 and 10 weeks; n=3 per time point) was performed by Affymetrix GeneChip®Mouse Gene 2.0 ST Arrays (902118) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Proteins were separated in 4-12% Nu-Page Bis-Tris (FANCA analysis) or NuPAGE 3-8% Tris-Acetate (FANCD2) polyacrylamide gels (Invitrogen) and transferred to nitrocellulose membranes (Amersham Biotech ...
-
bioRxiv - Cancer Biology 2021Quote: ... Protein lysates were run at 200V for an hour through either a 4-12% Bis-Tris or 3-8% Tris Acetate gel (Invitrogen), and then transferred at 300 mA for one hour in 15% methanol 1x Transfer Buffer on a methanol activated PVDF membrane ...
-
bioRxiv - Cell Biology 2023Quote: ... Equal amounts of total cell lysates were loaded to 4–12% Bis-Tris or 3–8% Tris-Acetate gels (Invitrogen) and transferred to 0.2 µm PVDF membranes via wet tank or semi-dry method (specified in the supplementary information) ...
-
bioRxiv - Biochemistry 2023Quote: ... Proteins were resolved on NuPAGE 3-8% (wt/vol) Tris-acetate or 4-12% (wt/vol) Bis-Tris gels (Invitrogen) and transferred to polyvinylidene difluoride (PVDF ...
-
Turanose induced WOX5 restores symbiosis in the Medicago truncatula cytokinin perception mutant cre1bioRxiv - Plant Biology 2020Quote: ... and immersed and incubated in the dark in staining solution 1 mM 5-bromo-4-chloro-3-indolyl-β-D-glucuronicacid (X-Gluc, Thermo Scientific), 50mM sodium phosphate buffer ...
-
bioRxiv - Molecular Biology 2019Quote: One microgram of peptides in a volume of 1-4 μL was loaded onto the Acclaim μ-Precolumn (0.5 mm х 3 mm, 5 μm particle size, Thermo Scientific) at a flow rate of 10 μL/min for 4 min in an isocratic mode of Mobile Phase C (2% MeCN ...
-
bioRxiv - Biochemistry 2021Quote: ... One microgram of peptides in a volume of 1-4 µL was loaded onto the Acclaim µ-Precolumn (0.5 mm х 3 mm, 5 µm particle size, Thermo Scientific) at a flow rate of 10 µL/min for 4 min in an isocratic mode of Mobile Phase C (2% acetonitrile (Sigma-Aldrich) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Lysates were cleared by centrifugation at 21,000 x g for 10 minutes at 4°C and protein concentration was determined by Bicinchoninic acid assay (Pierce, ThermoFisher Scientific). Proteins were reduced with 5 mM dithiothreitol for 30 minutes at 55°C ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... #2: 5’-gatcccGATTACTCGGCCATGATCAAAgcttcctgtcacTTTGATCATGGCCGAGTAATCttt ttta-3’ and 5’-agcttaaaaaaGATTACTCGGCCATGATCAAAgtgacaggaagcTTTGATCATGGCCGAGTAATgg-3’ were purchased from Invitrogen. The DNA oligo pairs were annealed and inserted into pEntryCla12-chickU6 shuttle vector using BamHI/HindIII site.
-
bioRxiv - Cancer Biology 2021Quote: ... and mPRs (PAQR5, 6, 7, 8, 9) using Power SYBR Green Master Mix with ViiA 7 Real-Time PCR System (Applied Biosystems). RT-qPCR plates with various cell-lines were prepared using an epMotion 5075 automated liquid handling system (Eppendorf) ...
-
bioRxiv - Synthetic Biology 2020Quote: ... affibody was incubated with 3-fold molar excess of Alexa 647 Succinimidyl Ester (Life Technologies) for 1 h at room temperature and desalted with Zeba Spin Desalting Column prior to labeling with Methyltetrazine.
-
bioRxiv - Cancer Biology 2023Quote: ... and TNFα (10 ng/ml) for 6 h and stained for cleaved Caspase 3/7 green (5 µM) and propidium iodide (2 µM) (Thermo Scientific) for an additional 30 min ...
-
bioRxiv - Cell Biology 2019Quote: ... 2,7-Dichlorodihydrofluorescein diacetate (DCFH-DA),3,3’-dihexyloxacarbocyanine iodide [DiOC6(3)] and N-[4-[6-[(acetyloxy)methoxy]-2,7-difluoro-3-oxo-3H-xanthen-9-yl]-2-[2-[2-[bis[2-[(acetyloxy)methoxy]-2-oxoethyl]amino]-5-methylphenoxy]ethoxy]phenyl]-N-[2-[(acetyloxy)methoxy]-2-oxoethyl]-,(acetyloxy)methyl ester (Fluo-4 AM) were purchased from Molecular Probes (Invitrogen, Eugene, OR, USA). Agarose was obtained from Lonza (Walkersville ...
-
bioRxiv - Cell Biology 2019Quote: ... methoxy]-2-oxyethyl] amino]-5-methyl-phenoxy] ethoxy]phenyl-N-[2-[(acetyloxy) methoxy]-2-oxyethyl]-(acetyloxy) methyl ester (Fluo-4/AM) were from Molecular Probes (Invitrogen, Eugene, OR, USA). M ...
-
Chemoproteomics of microbiota metabolites reveals small-molecule agonists for orphan receptor GPRC5AbioRxiv - Biochemistry 2021Quote: ... indole-3-acetatic acid (Fisher Scientific, Catalog #11453194), tryptamine (Sigma-Aldrich ...
-
Revisiting the role of Toxoplasma gondii ERK7 in the maintenance and stability of the apical complexbioRxiv - Microbiology 2021Quote: ... The NHS-Ester staining (Thermofisher, DyLight™ 488 NHS Ester) was used at 5μg/mL and incubated 1 hour in PBS ...
-
bioRxiv - Neuroscience 2021Quote: ... 7 g anti-μ cadherin-11 (Thermo Fisher Scientific Cat#32-1700) or 4 μg anti-HA antibodies (Millipore Sigma Cat#H6908) ...
-
bioRxiv - Microbiology 2023Quote: ... Cells were separated from supernatant by centrifugation at 15,000×g for 15 minutes at 4°C (ThermoFisher Fiberlite F15s-8×50c rotor). The supernatant was collected ...
-
bioRxiv - Developmental Biology 2022Quote: ... mixed with an equal volume of 5:1 acid phenol: chloroform (ThermoFisher Scientific), and centrifuged again ...
-
bioRxiv - Molecular Biology 2019Quote: ... and (3) 110,000 × g for 2 hours at 4°C with a Sorvall Discovery SE ultracentrifuge (Thermo Fisher Scientific) with an AH-650 rotor (k factor ...
-
bioRxiv - Clinical Trials 2019Quote: ... (Bruner and Siliciano, 2018), env (Forward: 5’-AGTGGTGCAGAGAGAAAAAAGAGC-3’, Reverse: 5’-GTCTGGCCTGTACCGTCAGC-3’, Probe: 5’/VIC/CCTTGGGTTCTTGGGA/3’/MGB) (Thermo Fisher Scientific) (Bruner et al. ...
-
bioRxiv - Clinical Trials 2019Quote: ... (Palmer et al., 2003) and pol (Forward: 5’-GCACTTTAAATTTTCCCATTAGTCCTA-3’, Reverse: 5’-CAAATTTCTACTAATGCTTTTATTTTTTC-3’, Probe: 5’/NED/AAGCCAGGAATGGATGGCC/3’/MGB) (Thermo Fisher Scientific) (Schmid et al. ...
-
bioRxiv - Cancer Biology 2020Quote: ... or sgKLF5 pool (5’- GUGCGCUCGCGGUUCUCUCG-3’; 5’- AGGACGUUGGCGUUUACGUG-3’; 5’- GCGUCAAGUGUCAGUAGUCG-3’) was transfected per well using Lipofectamine™ RNAiMAX (Thermofisher, 13778150). Media was changed after 72 hours for longer treatments.
-
bioRxiv - Immunology 2022Quote: ... custom primers and probes designed to amplify and label the Chlamydia 16S gene were used (forward: 5’-GGAGGCTGCAGTCGAGAATCT-3’; reverse: 5’-TTACAACCCTAGAGCCTTCATCACA-3’; probe 5’-6FAM-TCGTCAGACTTCCGTCCATTGCGA-TAM-3’; Fisher Scientific/Eurofins).
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies), and parasite burden was calculated based on the standard curve of known parasite contents(24).
-
bioRxiv - Microbiology 2023Quote: Susceptibility to bile salts (cholic acid and deoxycholic acid in a mixture of 1:1, Bile Salts No.3, Thermo Fisher Scientific Inc., Waltham, USA) was tested in two different concentrations ...
-
bioRxiv - Molecular Biology 2022Quote: A concentration of 6 × 103 cells was loaded with 5 mM 4-amino-5-methylamino-2’,7’- difluorofluorescein diacetate (DAF-FM, Molecular Probes, Thermo Fisher, Sao Paulo, Brazil) after 72 h of treatment ...
-
bioRxiv - Immunology 2022Quote: ... and 5 μL 7-AAD (Invitrogen, 00-6993-50). 7-AAD- ...
-
bioRxiv - Immunology 2022Quote: ... and 5 μL 7-AAD (Invitrogen, 00-6993-50). 7-AAD- ...
-
bioRxiv - Immunology 2023Quote: ... 5 μl of 7-AAD (Invitrogen, 00-6993-50) was included for dead cell exclusion.
-
bioRxiv - Immunology 2022Quote: ... targeting SAMHD1 (sense RNA 5’-GCAGAUAAGUGAACGAGAUTT-3’, antisense RNA 5’-AUCUCGUUCACUUAUCUGCAG-3’) or the negative control #1 siRNA using RNAiMAX (ThermoFisher, 13778-075). 24 h after transfection ...
-
bioRxiv - Microbiology 2024Quote: ... was added at a 1:2000 dilutions for 1 h at 37 °C, followed by adding TMB (3, 3, 5, 5′-tetramethylbenzidine) peroxidase substrate (Thermo Fisher Scientific) for 30 min ...
-
bioRxiv - Cell Biology 2020Quote: ... separated on a 3-8 % Tris-Acetate gel (Invitrogen) by SDS-PAGE ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3-8% Tris-Acetate gels (Thermo Fisher Scientific, EA0375PK2) were used ...
-
bioRxiv - Neuroscience 2023Quote: ... or 3-8% Tri-Acetate gel (EA03755BOX, Thermo Scientific) and transferred on to nitrocellulose membranes 0.2μm (#1704158 ...
-
bioRxiv - Cancer Biology 2023Quote: ... or 3-8% Tris-Acetate mini gels (Thermo Scientific) and transferred to nitrocellulose membrane ...
-
bioRxiv - Cell Biology 2023Quote: ... or 3-8% tris-acetate gel (Invitrogen; Thermo #WG1602BOX), and electro-transferred to a nitrocellulose membrane (Odyssey ...
-
bioRxiv - Genetics 2023Quote: ... or NuPAGETM 3-8% Tris-Acetate Gel (EA03755, INVITROGEN) using the running buffer MOPS SDS (NP0001 ...
-
bioRxiv - Molecular Biology 2023Quote: ... NuPAGE™ 3 to 8% Tris-Acetate gels (Invitrogen) were used.
-
bioRxiv - Molecular Biology 2024Quote: ... or 3-8% Tris-Acetate gels (Invitrogen; for CDH23). Proteins were transferred onto nitrocellulose membranes (BioRad ...
-
bioRxiv - Molecular Biology 2024Quote: ... and separated in either NuPAGE 3-8% (Invitrogen, #EA0375BOX) or 7% Tris-Acetate polyacrylamide gradient gels (Invitrogen ...
-
bioRxiv - Microbiology 2021Quote: ... 40 μg/mL 5-bromo-4-chloro-3-indolyl-beta-D-galactopyranoside (X-Gal) (Thermo Scientific) and 1 mM isopropyl beta-D-thiogalactopyranoside (IPTG ...
-
bioRxiv - Immunology 2019Quote: ... succinimidyl ester (Invitrogen) and pooled prior to antibody staining ...
-
bioRxiv - Biophysics 2022Quote: ... succinimidyl ester (Invitrogen), as previously described [59] ...
-
bioRxiv - Cell Biology 2023Quote: ... succinimidyl ester (Invitrogen) was mixed with fibrinogen solution in a 7.5:1 molar ratio for 1 hour at room temperature and then filtered through a HiTrap desalting column (GE Healthcare ...
-
bioRxiv - Genomics 2021Quote: ... Linker oligo sequences were: 5’ – TTCAGACGTGTGCTCTTCCGATCTNNNNNNNNNNCAGGCTACTCCGCTTAAGGGAC-3’ (linker 1, Invitrogen, UK) and 5’-GTCCCTTAAGCGGAGTAGCCTG/3AmMO/-3’ (linker 2 ...
-
bioRxiv - Microbiology 2023Quote: ... HSV-1 Probe FAM-5’-CGGCCCAACATATCGTTGACATGGC-3’-MGBNFQ (Thermo Fisher Scientific). The efficiency of each round of PCR was determined using 10-fold dilutions of Topo TA plasmids (Invitrogen AB ...