Labshake search
Citations for Thermo Fisher :
451 - 500 of 10000+ citations for 8 Bromo 3 iodo quinoline since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2021Quote: ... The 8-well plates (155409; Thermo Scientific) for HEK293-T and SW480 cells were coated with fibronectin bovine plasma (F1141-2MG ...
-
bioRxiv - Microbiology 2019Quote: ... and cultured in Essential 8 Medium (Gibco) with 100 μg/mL normocin (InvivoGen) ...
-
bioRxiv - Cell Biology 2020Quote: ... and GMP Essential 8 (A1517001, Life Technologies). For routine passaging ...
-
bioRxiv - Cell Biology 2022Quote: ... with 8% fetal bovine serum (FBS; Gibco) overnight at 37°C ...
-
bioRxiv - Neuroscience 2021Quote: ... in Essential 8 Medium (Thermo Fisher Scientific). For neural differentiation ...
-
bioRxiv - Neuroscience 2021Quote: ... using Essential 8™ medium (ThermoFisher scientific) at 37°C ...
-
bioRxiv - Cell Biology 2021Quote: ... supplied with 8% fetal bovine serum (Gibco), 2% chicken serum (Gibco ...
-
bioRxiv - Immunology 2022Quote: ... and 2 mg/ml collagenase 8 (Gibco) for 45 min at 37 °C ...
-
bioRxiv - Genetics 2020Quote: ... with Essential 8 Medium media (Life Technologies), and passaged using EDTA (Life Technologies ...
-
bioRxiv - Cancer Biology 2020Quote: ... purified recombinant human IL-8 (ThermoFisher Scientific) and CXCL1 (Sigma-Aldrich) ...
-
bioRxiv - Systems Biology 2021Quote: ... 20 mM Tris-HCl pH 8 (Invitrogen), 2 mM EDTA (Sigma-Aldrich) ...
-
bioRxiv - Cancer Biology 2020Quote: ... in Essential 8 medium (Thermo Fisher Scientific), while D3 cells and murine iPSCs were cultured on gelatin (Sigma ...
-
bioRxiv - Cell Biology 2021Quote: ... 8 U/mL proteinase-K (ThermoFisher, EO0492)) for 4 h at 37°C for digestion ...
-
bioRxiv - Developmental Biology 2021Quote: ... HuC/D 8 μg/ml (Molecular Probes), Rabbit anti-Foxn4 (1:50 ...
-
bioRxiv - Cell Biology 2020Quote: ... in Essential 8™ medium (ThermoFisher Scientific) and maintained under normoxic conditions in a humidified incubator.
-
bioRxiv - Immunology 2021Quote: ... embedded on an 8 well chamberglass (Nunc) in 50% Matrigel (Corning) ...
-
bioRxiv - Immunology 2022Quote: ... 8% CO2 in Expi293 expression medium (ThermoFisher) supplemented with 10 U/ml penicillin and 10 μg/ml streptomycin ...
-
bioRxiv - Systems Biology 2023Quote: ... and 8 µL ROX350 ladder (Thermo Fisher). Samples were then transferred to a 96-well plate in “concentrated” (4 µL sample + 11 µL ROX mix ...
-
bioRxiv - Neuroscience 2022Quote: ... in Essential 8 medium (Life technologies, A1517001). To passage hiPS cell colonies ...
-
bioRxiv - Molecular Biology 2022Quote: ... an 8-well chambered coverglass (ThermoFisher #155409) was conditioned in an oxygen-plasma cleaner to introduce the active oxygen group to the slide ...
-
bioRxiv - Cell Biology 2023Quote: ... with 8 mM HEPES (Thermo Fisher Scientific) via the abdominal inferior vena cava after cutting the portal vein to allow outflow of the perfusate ...
-
bioRxiv - Microbiology 2023Quote: ... IL-8 (PA579113, Thermo Fisher, 1:500), TNFα (AMC3012 ...
-
bioRxiv - Cell Biology 2023Quote: ... Novex WedgeWell 8-16% gels (Invitrogen, XP08165BOX) or NuPAGE 4-12% Bis-Tris Midi gels (Invitrogen ...
-
bioRxiv - Immunology 2023Quote: ... 8% FBS (Fisher Scientific, #MT35010CV, Lot: 14020001), Pen-Strep ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... for 8 min (hESC) or TrypLE (Gibco) for 15 min (d15/25 lung progenitors ...
-
bioRxiv - Bioengineering 2023Quote: ... coated Labtek 8-well chamber slides (Thermofisher) at a density of 360,000 cells/cm2 ...
-
bioRxiv - Bioengineering 2023Quote: ... 50 mM Tris-HCl (pH 8, Invitrogen), and 10 mM NaCl (S5150 ...
-
bioRxiv - Biochemistry 2023Quote: ... RNase H (8 U; Invitrogen 18021-014), DNase I (5 U ...
-
bioRxiv - Bioengineering 2023Quote: ... and 20 ng/mL FGF-8 (Invitrogen). After two days ...
-
bioRxiv - Neuroscience 2023Quote: ... Interferon Regulatory Factor 8 (IRF8, Thermo Fisher Scientific Cat# 12-9852-82 ...
-
bioRxiv - Neuroscience 2023Quote: ... in Essential 8 medium (A15169-01, Gibco). Doxycycline was used in the cell culture medium from this day onward ...
-
bioRxiv - Bioengineering 2023Quote: ... Microchem SU-8 2025 photoresist (Fisher Scientific) was dispensed on the wafer at 4 ml and spin-coated at 500 rpm for 12 s followed by 3,000 rpm for 45 s to create a uniform 30 µm layer of photoresist ...
-
bioRxiv - Microbiology 2023Quote: ... 8 µl of lipofectamine 2000 (Thermo Fisher) were used together with 1.2 µg of pLKO.1 plasmid expressing the shRNA against the protein of interest ...
-
bioRxiv - Cell Biology 2023Quote: ... 50 mM Tris pH 8 (AM9855G, Ambion) and 1 M NaCl (AM9760G ...
-
bioRxiv - Pathology 2024Quote: ... resuspended in Essential 8 Medium (ThermoFisher Scientific) containing H1152 (EMD Scientific ...
-
bioRxiv - Neuroscience 2024Quote: ... in Essential 8 medium (Life Technologies, A1517001). Cells were passaged every 4–5 days with UltraPure™ 0.5 mM EDTA ...
-
bioRxiv - Molecular Biology 2024Quote: ... Bolt 8% Bis-Tris Plus gels (Invitrogen) or self-cast 10% acrylamide gels (0.375 M Tris pH 8.8 ...
-
bioRxiv - Bioengineering 2024Quote: ... Microchem SU-8 2025 photoresist (Fisher Scientific) was dispensed on the wafer at 4 ml and spin-coated at 500 rpm for 12 s followed by 3,000 rpm for 45 s to create a uniform 30 µm layer of photoresist ...
-
bioRxiv - Biochemistry 2023Quote: ... The level of IL-8 in cell culture supernatants was determined using a human IL-8 ELISA kit (Invitrogen).
-
bioRxiv - Genomics 2024Quote: Cells were cultured in Gibco™ Essential 8™ media with Essential 8™ supplement (Thermo Fisher Scientific; A1517001) on growth-factor reduced Matrigel® Matrix (Corning® ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies) ...
-
bioRxiv - Microbiology 2020Quote: ... University of Bristol) were grown in DMEM supplemented with 8% FCS and 8% (v/v) tryptose phosphate broth (Life technologies). Penicillin and streptomycin (90 IU/ml ...
-
bioRxiv - Microbiology 2020Quote: ... Enzyme-linked immunosorbent assays (ELISAs) for human IL-8 were performed using the Human IL-8 ELISA Kit (ThermoFisher SCIENTIFIC) according to the manufacturer’s instructions ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Pro-inflammatory cytokine (IL-8) and (IL-6) release was determined using the IL-6 and IL-8 ELISA kit (Invitrogen) according to the manufacturer’s instructions (ThermoFisher).
-
bioRxiv - Genomics 2020Quote: Pellets were resuspended in 1ml resuspension buffer (10mM Tris pH 8, 1mM EDTA pH 8) and treated with 7.5 μl RNase A (Thermo Scientific) for 30min at 37C ...
-
bioRxiv - Biophysics 2022Quote: ... with a dilution factor of 8 × 10-8 and yellow-green (505/515) 40 nm fluorescent beads (F10720, Thermo Fisher) with a dilution factor of 8 × 10-6 in PBS and allowing them to deposit on a coverslip.
-
bioRxiv - Cancer Biology 2021Quote: ... and seeded in 8-well chamber slides (Nunc) for 3D culture ...
-
bioRxiv - Biophysics 2020Quote: ... Fixation buffer (PBS, 8% formaldehyde (28908, ThermoFisher Scientific), 0.2% glutaraldehyde (G7776-10ML ...
-
bioRxiv - Cancer Biology 2022Quote: ... supplemented with 8 ng/ml FGF-basic (Gibco), 0.1 mM β-mercaptoethanol (Gibco) ...
-
bioRxiv - Molecular Biology 2020Quote: ... in complete Essential 8 medium (Life Technologies #A1517001) supplemented with 1% Penicillin/Streptomycin (Invitrogen ...