Labshake search
Citations for Thermo Fisher :
201 - 250 of 10000+ citations for 7H 1 3 Thiazino 2 3 i purin 5 1H one 2 3 8 9 tetrahydro 2 thioxo since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... custom primers and probes designed to amplify and label the Chlamydia 16S gene were used (forward: 5’-GGAGGCTGCAGTCGAGAATCT-3’; reverse: 5’-TTACAACCCTAGAGCCTTCATCACA-3’; probe 5’-6FAM-TCGTCAGACTTCCGTCCATTGCGA-TAM-3’; Fisher Scientific/Eurofins).
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies), and parasite burden was calculated based on the standard curve of known parasite contents(24).
-
bioRxiv - Biochemistry 2020Quote: ... Primary antibodies were removed by 3 washes with 2% BSA 1x PBS and incubated with 2 μg/ml anti-rabbit IgG Alexa Fluor 594 (Thermo Fisher) for 2 h in the dark at 4°C ...
-
bioRxiv - Physiology 2023Quote: ... The final plasmids for the sense and antisense expression of daf-2 or aak-2 under the str-3 promoter were generated using Gateway Cloning Technology (Life Technologies) and injected into FLP-7 secretion line (SSR1164 ...
-
bioRxiv - Biochemistry 2021Quote: ... or with 0.5 µg/ml doxycycline for 2-3 days) were combined in a 1:1 ratio and loaded with 5 µg/ml Indo-1 (Molecular Probes, AAT Bioquest, Sunnyvale, USA) and 0.04% of pluronic F-127 (AAT Bioquest ...
-
bioRxiv - Developmental Biology 2022Quote: ... Maturation of released oocytes was induced by incubating for 1h at 16C in 3 μM 1-Methyladenine (Fisher Scientific, 5142-22-3). All embryos were raised in 0.22 μm filtered sea water (FSW ...
-
bioRxiv - Immunology 2019Quote: ... 5’-CCCTACTGTATCCTCATG-3’/5’-CTTACCTCCTCTTCAATAGC-3’ PRKDC: 5’-GGGGCATTTCCGGGTCCGGG-3’/5’-TGCCCTGCCCCCCACTCTGC-3’ Amplicons were cloned using the Zero Blunt TOPO PCR Cloning kit (ThermoFisher), prepared as plasmids ...
-
bioRxiv - Cell Biology 2022Quote: ... Guide RNA primer sets A (KS40 5’-ACCGACCACAGAAACTGCGACTAG -3’ and KS41 5’-AACCTAGTCGCAGTTTCTGTGGTC-3’) and B (KS42 5’-CCGTCCCACTGGCACCGCTTTATG-3’ and KS43 5’-AAACATAAAGCGGTGCCAGTGGGA-3’) were phosphorylated with T4 polynucleotide kinase (ThermoFisher) at 37°C for 30 min and annealed by cooling down from 85°C to 25°C at 0.1°C/sec ...
-
bioRxiv - Cell Biology 2020Quote: ... 5 micromols sodium sulfo-NHS and 5 micromols 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC) (Thermo Fisher #22980) in 10 μL of DMSO ...
-
bioRxiv - Neuroscience 2024Quote: ... The passage was performed twice per week (1:2 or 1:3) using Accutase (Cat #A1110501, Thermo Fisher Scientific) by vigorously breaking pellets to remove neuronal cells ...
-
bioRxiv - Cell Biology 2021Quote: ... BV-2 immortalized microglial cells (Blasi et al. 1990) (passage 3 to 8) cultured in macrophage serum-free medium (ThermoFisher 12065-074) were used ...
-
bioRxiv - Plant Biology 2023Quote: ... using primers GtEFF1 (5’-CCCTGCAAGCTCTTCCTCTTAG-3’) and GtEFR1 (5’-GCATGCGAGGTCCCAAAA-3’) with the TaqMan probe (5’-6FAM-ACTGCACAGACCATC-MGB-3’) (Thermo Scientific™, USA) (Keenan et al. ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3-8% Tris-Acetate gels (Invitrogen EA0375) were used to resolve all proteins ...
-
bioRxiv - Molecular Biology 2019Quote: ... separated in Nupage® 3-8% (Invitrogen) polyacrylamide gels and blotted on PVDF membranes using the Trans-Blot® Turbo™ system (Bio-Rad) ...
-
bioRxiv - Cell Biology 2021Quote: ... 3–8% Tris-acetate gels (Life Technologies. Proteins were transferred to nitrocellulose membrane by semi-dry transfer (Trans-Blot Turbo transfer system ...
-
bioRxiv - Cell Biology 2022Quote: ... or 3-8% Tris Acetate (Invitrogen, EA0375) polyacrylamide gels ...
-
bioRxiv - Cancer Biology 2023Quote: ... run on 3-8% gel (NuPAGE, Invitrogen) and probed using BRCA1 (Santa Cruz ...
-
bioRxiv - Biochemistry 2023Quote: ... and 3-8% Tris-Acetate (Invitrogen EA03785) polyacrylamide gels for Coomassie stain (Instant Blue Abcam AB119211 ...
-
bioRxiv - Molecular Biology 2024Quote: ... or 3-8% Tris-Acetate gels (Invitrogen) and transferred onto PVDF membranes using a wet blot system for 1 h at 100 V (Biorad) ...
-
bioRxiv - Cell Biology 2023Quote: ... the sample was incubated for 3 s and blotted for 2 s using the freezing plunger Vitrobot I (Thermo Fisher Scientific, USA). Grids were quickly frozen in liquid ethane cooled by liquid nitrogen and stored in liquid nitrogen until checked ...
-
bioRxiv - Neuroscience 2019Quote: ... 3 PBS washes were performed and then 2 hours of incubation in CY-5 goat anti-rabbit (1:1000, Invitrogen, ThermoFisher Scientific, A10523) diluted in 2%NGS-PBS ...
-
bioRxiv - Cell Biology 2021Quote: ... sense 5’-CAAAGGACAACUGUCAGACACAGAA-3’ and antisense 5’-UUCUGUGUCUGACAGUUGUCCUUUG-3’) were purchased from Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... sense 5’-CUACAAAGCUGAUGAAGAC-3’ and antisense 5’-GUCUUCAUCAGCUUUGUAG-3’) were purchased from Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2020Quote: ... Total RNA was isolated from sorted 2-3×10^5 CD34+ cells using the mirVANA miRNA isolation kit (Thermo Fisher) and subsequently processed using the Small RNA Library Prep kit (Norgen Biotek) ...
-
bioRxiv - Immunology 2019Quote: ... isolated lungs were cut into 2-3 mm2 sections and resuspended in 5 mL digestion solution of Roswell Park Memorial Institute (RPMI) 1640 Medium (Gibco) supplemented with 5 mM GlutaMax (Gibco) ...
-
bioRxiv - Microbiology 2021Quote: ... and cDNAs were synthesized using SARS-CoV-2 nucleocapsid (N) reverse primer N660R (5’-AGCAAGAGCAGCATCACCGCCATTGCCAGC-3’) and M-MLV reverse transcriptase (Invitrogen). Then ...
-
bioRxiv - Biochemistry 2022Quote: ... Peptides were separated using 50 cm Acclaim PepMap 100 analytical column (75 μm ID, 3 μm C18) in conjunction with a Pepmap trapping column (100μm × 2 cm, 5 μm C18) (Thermo Scientific) analysed with Orbitrap Fusion Tribrid mass spectrometer (Thermo-Fisher Scientific) ...
-
bioRxiv - Genomics 2023Quote: ... For the construction of the RNH2A KO clones, RNASEH2A (Chr19, exon 2) gRNA (5’-TAACAGATGGCGTAGACCAT-3’) was cloned into GeneArtTM CRISPR Nuclease Vector with OFP reporter (Invitrogen) following manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2023Quote: ... 3 x 5 min) on a rocking platform and stained with 4′,6-diamidino-2- phenylindole dihydrochloride (DAPI) (Life Technologies) staining (2 μM ...
-
bioRxiv - Microbiology 2021Quote: ... mixed with forward and reverse detection primers (T3DCD S1 forward [5’- TACGCGTTGATCACGACAAT-3’] and T3DCD S1 reverse [5’- TGGCGAGATTATTCCCTGAC-3’] or GAPDH forward [5’- ACCCAGAAGACTGTGGATGG-3’] and GAPDH reverse [5’- GGATGCAGGGATGATGTTCT-3’]) and SYBR Select Master Mix (Applied Biosystems), and then subjected to PCR using the StepOnePlus Real-Time PCR system (Applied Biosystems) ...
-
The skin environment controls local dendritic cell differentiation and function through innate IL-13bioRxiv - Immunology 2021Quote: ... FW 5’-CTCTCTGGGCGAAATCTGCT-3’ and REV 5’-GAGTGCTTTCGCTATGTTGTTCA-3’ for Clmn and FW 5’-TGATGGGTGTGAACCACGAG-3’ and REV 5’-GCCGTATTCATTGTCATACCAGG-3’ for Gapdh using a QuantStudio 7 (Applied Biosystems). Transcript levels are expressed as the ratio of 2−ΔCT (Transcript of interest)/2−ΔCT (Gapdh).
-
bioRxiv - Neuroscience 2020Quote: ... Some slices (used for experiments in Fig. 2 and 3) were cultured in media that included 2 % B-27 Supplement (Thermo Fisher Scientific). Slices were maintained at 37°C and 5 % CO2 and used for experiments at DIV10-15.
-
bioRxiv - Cell Biology 2022Quote: ... then incubated for 2-3 hours at room temperature with 2 µg/ml donkey anti-goat Alexa Fluor 488 (Cat# A21206, Thermo Fisher Scientific), 2 µg/ml donkey anti-rabbit Alexa Fluor 568 (Cat# A10037 ...
-
bioRxiv - Cell Biology 2023Quote: ... siCT (5’- CGUACGCGGAAUACUUCGAtt-3’, Ambion), siPALS1 (5’-UUCCUUAUGAUGAACUGGCtt-3’ ...
-
bioRxiv - Cancer Biology 2023Quote: ... 3-5 μL RNAiMAX (Invitrogen) were added to 500 uL serum-free RPMI-1640 and incubated at room temperature for 5 min ...
-
bioRxiv - Biophysics 2023Quote: ... in 3% BSA with a 1:50 ratio and 4’,6-diamidino-2-phenylindole (DAPI, Thermo Fisher Scientific) were employed ...
-
bioRxiv - Molecular Biology 2023Quote: ... Mix 1 contains 3 siRNAs (CliniSciences, CRH7929) and Mix 2 contains two siRNAs (ThermoFisher Scientific, 1299001 and 4392420). As a negative control ...
-
bioRxiv - Developmental Biology 2024Quote: ... Maturation of released oocytes was induced by incubating for 1h at 16°C in 3 μM 1-Methyladenine (Fisher Scientific, 5142-22-3).
-
bioRxiv - Cancer Biology 2021Quote: ... using a 10 min loading at 3 µL/min flow rate to a trap column (Acclaim™ PepMap™ 100, 2 cm × 75 µm, 3 µm, 100 Å - ThermoFisher Scientific). The separation was performed on an EASY-Spray™ C18 analytical column (25 cm × 75 µm ...
-
bioRxiv - Molecular Biology 2019Quote: ... incubated for 2–3 min at RT in trypsin (0.05% v/v; Gibco 25300-054), and tapped to release ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 12 mM 3-[4,5-Dimethylthiazol-2-yl]-2,5-diphenyltetrazolium (MTT) (Thermo Fisher Scientific, #M6494). After 4 hours ...
-
bioRxiv - Biochemistry 2020Quote: ... and SARS-CoV-2 [3]) was performed with Proteome Discoverer version 2.4 (Thermo Fisher Scientific). The search was restricted to human and SARS-COV-2 proteins ...
-
bioRxiv - Cell Biology 2021Quote: ... 3 μg of RNA was digested with Turbo DNase (2 U/μl, # AM1907, ThermoFisher Scientific). 500 ng of DNase-digested RNA was tagged with G/I tails in a 10 μl reaction ...
-
bioRxiv - Immunology 2022Quote: ... Cells were activated for 3 days in presence of 100 U/mL IL-2 (Gibco) and 1 µg/mL PHA (Remel).
-
bioRxiv - Cell Biology 2021Quote: ... washed 3 times and incubated with 4’,6-Diamidino-2-phenylindole (DAPI; 2mg/ml) (Invitrogen) in PBS for 5 minutes ...
-
bioRxiv - Microbiology 2021Quote: ... or with 2 µM CellEvent™ Caspase-3/7 Green Detection Reagent (Thermo Fisher Scientific) for 30 min at room temperature (1:150 in AnnexinV binding buffer-Biolegend) ...
-
bioRxiv - Microbiology 2021Quote: ... and 2-3 cm) after measuring the DNA concentration with Qubit (QubitⓇ 2.0 Fluorometer, Invitrogen). We obtained eight metagenomes from Lake Sarnen (deepest and shallow_inflow station for March ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... where an Acclaim PepMap 100 (2 cm x 75 μm, 3 μm particles; Thermo Fisher) pre-column was connected in front of an EASY-Spray PepMap RSLC C18 reversed phase column (50 cm x 75 μm ...
-
bioRxiv - Molecular Biology 2019Quote: ... an Acclaim PepMap 100 (2 cm x 75 μm, 3 μm particles, Thermo Fisher Scientific) pre-column was connected in front of an EASY-Spray PepMap RSLC C18 reversed phase column (50 cm x 75 μm ...
-
bioRxiv - Cell Biology 2020Quote: ... After washing and nuclear counterstaining with 4’,6-diamidino-2-phenylindole (DAPI, ThermoFisher, 3 µM), sections were mounted on microscopic slides using Aqua Poly/Mount (Polysciences) ...