Labshake search
Citations for Thermo Fisher :
151 - 200 of 10000+ citations for 7H 1 3 Thiazino 2 3 i purin 5 1H one 2 3 8 9 tetrahydro 2 thioxo since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
ZMYM2 is essential for methylation of germline genes and active transposons in embryonic developmentbioRxiv - Molecular Biology 2022Quote: ... Cells were passaged every 2-3 days using 0.05% Trypsin-EDTA (Gibco, 25300062). These cells were cultured in Knockout™ D-MEM (Gibco ...
-
bioRxiv - Immunology 2023Quote: ... and the pellet resuspended in 2-3 mL of TrypLE Express (Gibco # 12605010) for 15-20 min at 37°C to dissociate the organoids into single cells ...
-
bioRxiv - Immunology 2023Quote: ... and the pellet resuspended in 2-3 mL of TrypLE Express (Gibco # 12605010) for 12 min at 37°C to keep the LPC spheroids as aggregates ...
-
bioRxiv - Biochemistry 2022Quote: ... and 2 µM CellEvent™ Caspase-3/7 Green Detection Reagent (ThermoFisher Scientific). Images were captured automatically every two hours for 48 hours using the IncuCyte™ S3 Live-Cell Analysis Instrument (Essen BioScience) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Following 3 days of selection with 2 µg/ml puromycin (Gibco, A11138-03), reference samples were collected (t=0 ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... for 2-3 hours at room temperature and incubated with Hoechst 33342 (Invitrogen) for 10 min at room temperature ...
-
bioRxiv - Cell Biology 2023Quote: ... and treated with 2 µM Caspase-3/7 Green detection reagent (C10423, Invitrogen) along with the specified compounds ...
-
bioRxiv - Neuroscience 2023Quote: ... Cells were passaged every 2-3 days using TryplLE™ express enzyme (GIBCO) and trypsin inhibitor (GIBCO).
-
bioRxiv - Genetics 2023Quote: ... each coverslip was incubated in 3 μl fura-2 acetoxymethyl (AM) ester (Invitrogen) in 1X HBSS containing 5 mg/ml BSA (Sigma- Aldrich ...
-
bioRxiv - Bioengineering 2023Quote: ... To this mixture we added glycerol 2-phosphate (3 M, Thermo Fisher Scientific) and (GT)15-SWCNTs (3.75 mg/L ...
-
bioRxiv - Genomics 2024Quote: ... Cells were passaged every 2-3 days using 0.25% trypsin-EDTA (#25200056, Gibco) to keep them below 80% confluency ...
-
bioRxiv - Cancer Biology 2023Quote: ... Capan-2 and BxPC-3 cell lines were cultured in RPMI medium (Gibco) supplemented with 10% FBS (Gibco ...
-
bioRxiv - Biochemistry 2021Quote: ... followed by 2 weeks of selection with 3 μg mL−1 of puromycin (Thermo Fisher Scientific). Then ...
-
bioRxiv - Microbiology 2021Quote: ... A recombinant lentivirus vector expressing the coding sequence of the EBV transactivator BZLF1 under control of a tetracycline-regulated promoter was constructed by cloning the open reading frame amplified with the primers 5’-CGACCGGTATGATGGACCCAAACTCGAC-3’ and 5’-CGACGCGTTTAGAAATTTAA GAGATCCTCGTGT-3’ into the Age I and Mlu I sites of the pTRIPZ lentiviral vector (Thermo Fisher Scientific, USA). For virus production ...
-
bioRxiv - Biochemistry 2023Quote: ... 5’-UUCUCCGAACGUGUCACGUTT-3’ and 5’-ACGUGACACGUUCGGAGAATT-3’ using Lipofectamine RNAiMIX reagent (Invitrogen) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2021Quote: ... in Tris-buffered PBS/ 0.1 % Tween 20 for 1 h at room temperature they were incubated overnight at 4 °C with the following antibodies: rabbit polyclonal anti-2′,3′-cyclic nucleotide 3′-phosphodiesterase (CNPase; 49 kDa; 1:1000; Thermo Fisher Scientific, Waltham, MA, USA), mouse monoclonal anti-myelin-associated glycoprotein (MAG ...
-
bioRxiv - Cell Biology 2019Quote: RNF168 si #1: 5’- GGCGAAGAGCGAUGGAGGATT-3’ (Ambion)
-
bioRxiv - Neuroscience 2021Quote: ... The brains were then washed in PBST-2 (PBS containing 0.1% Triton X-100) for 3 x 2 mins and blocked with SeaBlock blocking buffer (Thermo Fisher) for 15 mins at room temperature ...
-
bioRxiv - Neuroscience 2023Quote: ... particle size = 3 μm, C18, L = 2 cm; analytical column: particle size = 2 μm, C18, L = 50 cm; PepMap, Dionex/Thermofisher). Peptides eluting from the column were ionized using an Orbitrap Elite (Thermofisher).
-
bioRxiv - Bioengineering 2023Quote: ... pRSV-Rev = 5: 3: 2) were co-transfected into HEK-293T cells at a ratio of 1:1 using lipofectamine 3000 (Invitrogen, USA, Cat: #L3000015). After 48 h ...
-
bioRxiv - Neuroscience 2023Quote: ... An imaging window was constructed from three layers of microscope cover glass (1 x 5 mm, 2 x 3 mm diameter, Fisher Scientific, no. 1) joined with a UV-curable optical glue (NOR-61 ...
-
bioRxiv - Cell Biology 2020Quote: ... reverse: 5’-GGGGTCGGGAGGAACGG-3’ (Macrogen, South Korea) and beta-actin forward: 5’-CCTGGTCGGTTTGATGTT-3’ and reverse: 5’-GTGCGACGAAGACGA-3’ (Invitrogen, USA). Data analysis was made in CFX ManagerTM Software (BioRad ...
-
bioRxiv - Biochemistry 2023Quote: ... samples were blotted at 100% humidity for 3 s (13°C, 0 s drain time, blot force -3 to +2) with a Vitrobot Mark IV (Thermo Fisher Scientific) and plunged into liquid ethane ...
-
bioRxiv - Cell Biology 2021Quote: ... were transiently transfected into 8 × 104 U2OS 2-6-3 cells in 4-well chamber slides using Lipofectamine 2000 reagent (Invitrogen, 11668019) according to the manufacturer’s instructions.
-
bioRxiv - Microbiology 2022Quote: Proteins (8 μM final) were incubated with 0.16 mM of (2'-(or-3')-O-(trinitrophenyl) adenosine triphosphate (TNP-ATP) (Thermo Fisher Scientific), in 50 μl of Binding Buffer (10 mM HEPES-KOH (pH 8) ...
-
bioRxiv - Microbiology 2020Quote: ... Approximately 3 kb RT-PCR products covering the S gene deletion were amplified from the viral RNA using the gene specific primers F9newF and F9newR (5’-TAAGGTTGGTGGTAATTATAATTACCTG-3’ and 5’-AAAATAGTTGGCATCATAAAGTAATGGG-3’) and a SuperScript™ IV One-Step RT-PCR System (Invitrogen™, ThemoFisher). A region spanning the deletion was sequenced using primers Wu_24_L and Wu_24_R (5’-TTGAACTTCTACATGCACCAGC-3’ and 5’-CCAGAAGTGATTGTACCCGC-3’).
-
bioRxiv - Microbiology 2022Quote: ... and a shorter fragment from the C terminus of NSP3 ORF to 3’UTR region was amplified with the primer pairs NSP3 C termF 5’ CATTGCACGCTTTTGATGACTTAG 3’ and NSP3_3’UTR 5’GGCCACATAACGCCCCTATAG 3’ similarly using Superscript III One-Step RT-PCR System with Platinum Taq DNA polymerase (Invitrogen). Amplified PCR products were resolved by electrophoresis on 0.8% agarose gels in Tris-acetate-EDTA buffer ...
-
bioRxiv - Cancer Biology 2022Quote: ... 10 μL of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT, concentration 5 mg/mL, Invitrogen, cat. M6494) in PBS was added to each well containing culture medium and incubated for 2.5 h at 37 °C ...
-
bioRxiv - Neuroscience 2021Quote: ... The culture medium was changed every 2 to 3 days and the cells were split every 5 to 7 days using 0.25% Trypsin-EDTA (Gibco), up to 20 times ...
-
bioRxiv - Molecular Biology 2022Quote: Fresh tissue samples were washed 2–3 times in PBS and incubated in 5 U/ml dispase (ThermoFisher Scientific) supplemented with antibiotics (penicillin 50U/I and streptomycin 50 mg/ml ...
-
bioRxiv - Biochemistry 2022Quote: ... 4,4-difluoro-5-(2-thienyl)-4-bora-3a,4a-diaza-s-indacene-3-dodecanoic acid (BODIPY-C12, Invitrogen D3835), was dissolved in 100% ethanol and conjugated to 10% bovine serum albumin ...
-
bioRxiv - Neuroscience 2022Quote: BDA was visualized with fluorophore-conjugated streptavidin (Thermo Fisher Scientific, Table 2; 1:1,000 for 3 h). The reaction was enhanced using the biotinylated tyramine (BT)-glucose oxidase (GO ...
-
bioRxiv - Microbiology 2022Quote: Anti-ORF8 mAb (#1-3-2) was coupled to aldehyde/sulfate latex beads (Thermo Fisher Scientific A37304). The antibody was mixed with the latex beads and shaken at room temperature overnight ...
-
bioRxiv - Genomics 2019Quote: ... Round 2 and 3 PCRs were followed in real time using SYBR Green (Invitrogen) and stopped prior to plateauing ...
-
bioRxiv - Cell Biology 2021Quote: ... Cells were passaged every 2-3 days by washing with HBSS (Gibco, cat#14170), trypsinizing using 0.25% Trypsin-EDTA (Gibco ...
-
bioRxiv - Microbiology 2021Quote: ... 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MMT) was obtained from Thermo Fisher. Crystal violet was purchased from VWR ...
-
bioRxiv - Bioengineering 2020Quote: Nbs were diluted in a 2- or 3-fold series in Opti-MEM (Thermofisher). Each Nb dilution (110 μl ...
-
bioRxiv - Physiology 2021Quote: ... cells were fed every 2-3 days with DMEM + 10% FBS (Thermo fisher Scientific) until differentiation was complete at day 10.
-
bioRxiv - Immunology 2022Quote: ... The band are visualized with gel electrophoresis using 2-3% agarose (#16500500, Thermo Fisher) gel with SYBR Safe dye (#S33102 ...
-
bioRxiv - Genomics 2019Quote: ... Round 2 and 3 PCRs were followed in real time using SYBR Green (Invitrogen) and stopped prior to plateauing ...
-
bioRxiv - Neuroscience 2022Quote: ... Approximately 2-3 sections were mounted on each Superfrost Plus slide (Thermo Fisher Scientific). All sections were air-dried at −20 ° C for 1 hour and afterwards stored at −80 ° C.
-
bioRxiv - Genomics 2023Quote: ... use 10 μL for 2-3 ml of blood) or EDTA (0.5M EDTA, Gibco, cat ...
-
bioRxiv - Cell Biology 2023Quote: ... MCEC were split every 2-3 days using TrypLE express enzyme (GibcoTM, Thermo Scientific) for 5min at 37°C ...
-
bioRxiv - Genetics 2024Quote: ... and 2 µl of DNA using QuantStudioTM 3 real-time PCR system (ThermoFisher Scientific). For the amplification of GLS promoter region upstream of the repeat ...
-
bioRxiv - Neuroscience 2023Quote: FOs from 2 or 3 independent differentiations were fixed using 4% paraformaldehyde (Thermo Scientific) in PBS (Gibco ...
-
bioRxiv - Systems Biology 2024Quote: ... Cells were passaged every 2-3 days using 0.05% Trypsin/EDTA (Gibco™, 25300062). Cell density was 5x 104 per well for the experiments in the μ-Slide (ibidi ...
-
bioRxiv - Molecular Biology 2024Quote: The 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-2H-tetrazolium bromide (MTT, Thermo Scientific) assay was performed on cells seeded and treated in 96 plates for 72 hours with the free doxorubicin or doxo-EVs ...
-
bioRxiv - Clinical Trials 2019Quote: ... (Bruner and Siliciano, 2018), env (Forward: 5’-AGTGGTGCAGAGAGAAAAAAGAGC-3’, Reverse: 5’-GTCTGGCCTGTACCGTCAGC-3’, Probe: 5’/VIC/CCTTGGGTTCTTGGGA/3’/MGB) (Thermo Fisher Scientific) (Bruner et al. ...
-
bioRxiv - Clinical Trials 2019Quote: ... (Palmer et al., 2003) and pol (Forward: 5’-GCACTTTAAATTTTCCCATTAGTCCTA-3’, Reverse: 5’-CAAATTTCTACTAATGCTTTTATTTTTTC-3’, Probe: 5’/NED/AAGCCAGGAATGGATGGCC/3’/MGB) (Thermo Fisher Scientific) (Schmid et al. ...
-
bioRxiv - Cancer Biology 2020Quote: ... or sgKLF5 pool (5’- GUGCGCUCGCGGUUCUCUCG-3’; 5’- AGGACGUUGGCGUUUACGUG-3’; 5’- GCGUCAAGUGUCAGUAGUCG-3’) was transfected per well using Lipofectamine™ RNAiMAX (Thermofisher, 13778150). Media was changed after 72 hours for longer treatments.