Labshake search
Citations for Thermo Fisher :
351 - 400 of 10000+ citations for 7 Oxa 3 azabicyclo 4.1.0 heptane 1 methyl 3 propyl 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Synthetic Biology 2022Quote: ... at 3:1 bead:cell ratio in AIM-V media (Gibco) supplemented with 5% FBS ...
-
bioRxiv - Neuroscience 2023Quote: ... in HBSS and 1 μM YOYO-3 iodide (Thermofisher, Y3606) in the culture media ...
-
bioRxiv - Biochemistry 2023Quote: ... 3-Isobutyl-1-methylxanthine (IBMX) was from Acros Organics (#228420050). PF-04447943 was purchased from MedChem Express (#HY-15441/CS-0942) ...
-
bioRxiv - Neuroscience 2023Quote: ... Anti-Adenylate Cyclase 3 (IF: 1:500, Invitrogen, PA5-35382); Anti-Ephrin-B1 (IF ...
-
bioRxiv - Cell Biology 2024Quote: ... or 647-conjugated phalloidin (1-3 unit/mL; Life Technologies) 30 minutes ...
-
bioRxiv - Genetics 2021Quote: ... RNA was extracted from control and CRISPR-Cas9 targeted Calu-3 cells (N = 3 biological replicates, with 3 technical replicates per experiment per condition) and prepared using Trizol Reagent (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2021Quote: ... mixed with forward and reverse detection primers (T3DCD S1 forward [5’- TACGCGTTGATCACGACAAT-3’] and T3DCD S1 reverse [5’- TGGCGAGATTATTCCCTGAC-3’] or GAPDH forward [5’- ACCCAGAAGACTGTGGATGG-3’] and GAPDH reverse [5’- GGATGCAGGGATGATGTTCT-3’]) and SYBR Select Master Mix (Applied Biosystems), and then subjected to PCR using the StepOnePlus Real-Time PCR system (Applied Biosystems) ...
-
bioRxiv - Microbiology 2021Quote: ... and customized si-KIF4 3′ UTR targeting endogenous KIF4 mRNA 3’-UTR region (5′-GGAAUGAGGUUGUGAUCUUTT-3′) were purchased from Thermo Fisher Scientific.
-
bioRxiv - Cell Biology 2020Quote: ... reverse: 5’-GGGGTCGGGAGGAACGG-3’ (Macrogen, South Korea) and beta-actin forward: 5’-CCTGGTCGGTTTGATGTT-3’ and reverse: 5’-GTGCGACGAAGACGA-3’ (Invitrogen, USA). Data analysis was made in CFX ManagerTM Software (BioRad ...
-
bioRxiv - Neuroscience 2022Quote: ... total RNA was extracted from freshly-dissected n=3 young (3-month-old) or n=3 aged (18-month-old) zebrafish brain in TRIzol (Invitrogen, 15596). Three independent experimental replicates were used for bulk RNA sequencing ...
-
bioRxiv - Immunology 2022Quote: ... and 0.75% w/v 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate (CHAPS) in a hydrated 10K molecular weight cutoff dialysis cassette (Thermo Scientific). S ‘2P’ and HexaPro IMAC elution fractions were concentrated to ∼ 1 mg/mL and dialyzed three times into 50 mM Tris pH 8 ...
-
bioRxiv - Immunology 2020Quote: ... and 0.75% w/v 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate (CHAPS) in a hydrated 10K molecular weight cutoff dialysis cassette (Thermo Scientific). S-2P IMAC elution fractions were concentrated to ~1 mg/mL and dialyzed three times into 50 mM Tris pH 8 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Pierce premium grade N-hydroxysulfosuccinimide (sulfo-NHS, PG82071) and 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDC, 22980) were purchased from Thermo Fisher Scientific.
-
bioRxiv - Neuroscience 2022Quote: ... Quantitative RT-PCR on the mouse Zdhhc17 gene using primers spanning exons 1 and 2 (5’-ACCCGGAGGAAATCAAACCACAGA-3’ and 5’-TACATCGTAACCCGCTTCCACCAA-3’) and Sso/Advanced Universal SYBR green supermix (Fisher Scientific) was performed on CFX96 Real Time System (C1000 Touch Thermal Cycler ...
-
bioRxiv - Microbiology 2022Quote: ... PCR products (1□μg) of desired templates were 3’ end-labeled using a Pierce biotin 3’ End DNA Labeling Kit (Thermo Scientific). The resulting probe reaction mixtures were electrophoresed on a 0.8% agarose gel for 30 min at 100 V and then gel purified with a NucleoSpin Gel and PCR Clean-up kit (Takara Bio USA) ...
-
bioRxiv - Cell Biology 2023Quote: ... or Stealth siRNAs targeting coding sequences of human EZH2mRNA (5′-GACCACAGUGUUACCAGCAUUUGGA-3′: EZH2 #1, and 5′-GAGCAAAGCUUACACUCCUUUCAUA-3′: EZH2 #2) were obtained from Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... cells were blocked for 1 h in 3% BSA/PBS and incubated with rabbit-anti-GFP (1:50 in 3%BSA/PBS, 200 µl/well, Invitrogen, G10362) for 1 h at 37 °C ...
-
bioRxiv - Immunology 2023Quote: ... viable CD45-CD34+Sca-I- cells were sorted from epidermal single cell suspensions of 1-month-old EGFRΔEgr2 (n=3) and littermate controls (n=3) into Trizol LS Reagent (Thermo Fisher Scientific) using a FACS Aria III ...
-
bioRxiv - Immunology 2021Quote: ... To obtain Mfs purified monocytes were plated on 24 well plates 3 × 105 cells/well and cultured for 7 days in Macrophage-SFM (Gibco, Life Technologies ...
-
bioRxiv - Bioengineering 2020Quote: Total RNA was extracted from HTM cells ± DEX at 7 d (N = 3 per group and donor) using PureLink RNA Mini Kit (Invitrogen). RNA concentration was determined with a NanoDrop spectrophotometer (Thermo Fisher Scientific) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Cell death was assessed by measuring caspase 3 cleavage using a CellEvent Caspase3/7 Green Flow Cytometry kit (Thermo Fisher), according to the manufacturer’s descriptions ...
-
bioRxiv - Cell Biology 2021Quote: ... The tissues were then digested in room temperature for 7 min in a 3-mL Hank’s solution containing 0.25% Trypsin (Thermo Fisher, 15090046) and 0.1 μg/μL DNase (Sigma D5025 ...
-
bioRxiv - Cancer Biology 2022Quote: mScarlet-fascin/fascin KD or mScarlet/fascin KD HeLa cells were plated with 2 mM CellEvent Caspase-3/7 Green Detection Reagent (ThermoFisher) in CellCarrier Ultra 384 well plates (PerkinElmer ...
-
bioRxiv - Zoology 2022Quote: ... 2.3 × 105 Huh-7 cells were transfected with 2 µg of pSpCas9-BB-2A-GFP-sgPURA using Lipofectamine 2000 (Invitrogen) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... Quantitative PCR was performed using SYBR green reagents on an Applied Biosystems QuantStudio 3 and ViiA 7 Real-Time PCR Systems (ThermoFisher).
-
bioRxiv - Cell Biology 2020Quote: ... FACS analysis of transfected BEAS-2B cells for caspase 3 & caspase 7 along with SYTOX AADvancedTM Dead Cell Stain was performed per manufacturer’s protocol (Thermo Scientific).
-
bioRxiv - Physiology 2021Quote: ... JC-1 dye was added 10 min prior to recording (ex.488/em.535 and em.590) while CellEvent Caspase 3/7 (ThermoFisher) was added immediately prior to recording (ex.495/em.540).
-
bioRxiv - Immunology 2021Quote: ... NKp46+ and stained as indicated by manufacturer’s protocol with Cell Event Caspase 3/7 Green Flow Cytometry Assay Kit (Molecular Probes). All samples were analyzed using BD Canto FACS instrument ((BD Biosciences ...
-
bioRxiv - Genomics 2021Quote: ... Apoptosis staining was performed using the CellEvent Caspase-3/7 Green Flow Cytometry Assay Kit (Thermo Fisher Scientific, Waltham, MA). Stained cell suspensions were measured with the BD LSRFortessa Cell Analyzer (BD Biosciences ...
-
bioRxiv - Immunology 2022Quote: ... 5-7 × 106 cells were resuspended in 3 mL of FACS buffer (4% FBS in phosphate buffered saline (PBS, Gibco)) and sorted at the University of Massachusetts Amherst Flow Cytometry Core Facility using a BD FACSAria Fusion (Becton Dickinson) ...
-
bioRxiv - Microbiology 2022Quote: ... CellEvent™ Caspase-3/7 Green Detection Reagent (C10723) and PrestoBlue™ Cell Viability Reagent (A13261) were purchased from ThermoFisher Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... the COS-7 cells were transfected with plasmids encoding tubulin (3×mEmerald-ensconsin) and ER (mCherry-KDEL) by using Lipofectamine 3000 (Invitrogen) according to the manufacturer’s protocol17 ...
-
bioRxiv - Biochemistry 2023Quote: ... Cell proliferation was assessed at different time points (3, 5, 7 and 9 days) using AlamarBlue Cell Viability Reagent (Invitrogen) per manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... the media was replaced with DMEM + 10% FBS + CellEvent Caspase-3/7 Detection Reagent (Green) according to the manufacturers recommendations (Invitrogen). The plate was then imaged every 15 minutes using phase and GFP channels in the ZEISS Celldiscoverer 7 Automated Live Cell Imager set to 42°C at 5% CO2 and 20% O2 ...
-
bioRxiv - Neuroscience 2022Quote: ... 10% 3 kD or 10 kD biotinylated dextran amines (3 kD BDA, Invitrogen D7135 ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... #2: 5’-gatcccGATTACTCGGCCATGATCAAAgcttcctgtcacTTTGATCATGGCCGAGTAATCttt ttta-3’ and 5’-agcttaaaaaaGATTACTCGGCCATGATCAAAgtgacaggaagcTTTGATCATGGCCGAGTAATgg-3’ were purchased from Invitrogen. The DNA oligo pairs were annealed and inserted into pEntryCla12-chickU6 shuttle vector using BamHI/HindIII site.
-
bioRxiv - Biophysics 2022Quote: ... and 2-3 μL of the freshly phase-separated sample was placed into a chamber made on a glass slide (Fisher Scientific 3” × 1” × 1 mm). The chamber made by using double-sided tape was then sealed with a square coverslip to avoid evaporation of the sample ...
-
bioRxiv - Neuroscience 2023Quote: ... sections were incubated with following primary antibodies and/or labelling agents: anti-GFP (Invitrogen, #11122, 1:800, 3 days or Invitrogen, #10262, 1:800, 3 days), anti-V5 (Invitrogen ...
-
bioRxiv - Microbiology 2020Quote: ... COL1A1 (5’-CGAAGACATCCCACCAATC-3’ and 5’-ATCACGTCATCGCACAACA-3’), ALP (5’-TCACTCTCCGAGATGGTGGT-3’ and 5’-GTGCCCGTGGTCAATTCT-3’) (IDT, Coralville, USA) and viral non-structural (nsP1) gene (Applied Biosystems, USA) (5’-GGGCTATTCTCTAAACCGTTGGT-3’ and 5’-CTCCCGGCCTATTATCCCAAT-3’ ...
-
bioRxiv - Clinical Trials 2019Quote: ... (Bruner and Siliciano, 2018), env (Forward: 5’-AGTGGTGCAGAGAGAAAAAAGAGC-3’, Reverse: 5’-GTCTGGCCTGTACCGTCAGC-3’, Probe: 5’/VIC/CCTTGGGTTCTTGGGA/3’/MGB) (Thermo Fisher Scientific) (Bruner et al. ...
-
bioRxiv - Clinical Trials 2019Quote: ... (Palmer et al., 2003) and pol (Forward: 5’-GCACTTTAAATTTTCCCATTAGTCCTA-3’, Reverse: 5’-CAAATTTCTACTAATGCTTTTATTTTTTC-3’, Probe: 5’/NED/AAGCCAGGAATGGATGGCC/3’/MGB) (Thermo Fisher Scientific) (Schmid et al. ...
-
bioRxiv - Cancer Biology 2020Quote: ... or sgKLF5 pool (5’- GUGCGCUCGCGGUUCUCUCG-3’; 5’- AGGACGUUGGCGUUUACGUG-3’; 5’- GCGUCAAGUGUCAGUAGUCG-3’) was transfected per well using Lipofectamine™ RNAiMAX (Thermofisher, 13778150). Media was changed after 72 hours for longer treatments.
-
bioRxiv - Immunology 2022Quote: ... custom primers and probes designed to amplify and label the Chlamydia 16S gene were used (forward: 5’-GGAGGCTGCAGTCGAGAATCT-3’; reverse: 5’-TTACAACCCTAGAGCCTTCATCACA-3’; probe 5’-6FAM-TCGTCAGACTTCCGTCCATTGCGA-TAM-3’; Fisher Scientific/Eurofins).
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies), and parasite burden was calculated based on the standard curve of known parasite contents(24).
-
bioRxiv - Cell Biology 2022Quote: ... 3 ml was diluted 1:1 with PBS (Thermo Fisher Scientific, Waltham, MA) and kept on ice for purity analysis by flow cytometry ...
-
bioRxiv - Cancer Biology 2020Quote: ... n = 3) or oligopyridylamides (5 µM ADH-1 or ADH-6, n = 3) using a combination of both TriZol (Thermo Fisher Scientific) and RNAeasy Mini Kit (Qiagen ...
-
bioRxiv - Cell Biology 2021Quote: Cross-linking experiments of Sgo11-415 and CPCISB10-280 were performed using 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDC, Thermo Fisher Scientific) in the presence of N-hydroxysulfosuccinimide (NHS ...
-
bioRxiv - Microbiology 2019Quote: ... and then induced to differentiate by culturing for further 3 days in a 3:1 mixture of DMEM and Ham’s F12 media (Invitrogen, Palo Alto, CA) containing FCS (10%) ...
-
bioRxiv - Cell Biology 2022Quote: ... The C2C12 cells were transfected with 2 μg plasmids (L-Cas9n-EGFP:R-Cas9n-puro=3:1) by electroporation (1650 v/10 ms/3 pulses) with the Neon Transfection System Kit (Thermo Fisher Scientific). The cells were seeded overnight to 24-well plates containing an antibiotic-free complete mediums ...
-
bioRxiv - Developmental Biology 2022Quote: ... Maturation of released oocytes was induced by incubating for 1h at 16C in 3 μM 1-Methyladenine (Fisher Scientific, 5142-22-3). All embryos were raised in 0.22 μm filtered sea water (FSW ...