Labshake search
Citations for Thermo Fisher :
201 - 250 of 10000+ citations for 7 Oxa 3 azabicyclo 4.1.0 heptane 1 methyl 3 propyl 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: The panel of synthetic peptide standards and the products of immunoprecipitated heparan-sulfate 6-O-sulfotransferase 1/2/3 (H6ST-1/2/3) in vitro Tyr sulfation assays were analyzed using Proteome Discoverer 2.4 (Thermo Scientific) in conjunction with MASCOT 59 against either a custom database of all (12 ...
-
bioRxiv - Cancer Biology 2021Quote: ... and TO-PRO-3 (1:3000; Thermo Fisher) for fluorescent labelling of living and dead cells (‘Imaging medium’) ...
-
bioRxiv - Bioengineering 2019Quote: ... TOPRO-3 (1:1000, in PBS) (Invitrogen, USA) was used for 15 min at room temperature to stain the nuclei.
-
bioRxiv - Genetics 2021Quote: ... 8ul of 1:3 Vectashield (Thermo Fisher Scientific) DAPI:PBS was added to samples and allowed to incubate for 5 min ...
-
bioRxiv - Biophysics 2021Quote: ... 1× 10−3 М glutamine (Gibco, Cat:25030149) and 2 mg/ml gentamicin (Invitrogen ...
-
bioRxiv - Cell Biology 2021Quote: ... in 1:3 ratio using lipofectamine (Life Technologies) following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... TO-PRO-3 (Thermo Fisher T3605, 1:10,000) to label dead cells ...
-
bioRxiv - Neuroscience 2021Quote: ... the DNA dye TOPRO-3 (1:1000, Invitrogen), diluted in a blocking buffer for 2 h at 24 °C ...
-
bioRxiv - Cell Biology 2021Quote: ... pan-cytokeratin (ThermoFisher, 3-9003-82, 1/50), pSmad1/5/8 (Merck ...
-
bioRxiv - Molecular Biology 2022Quote: ... then washed 3 times with 1×PBS (Invitrogen). Roots were then squashed under coverslips onto slides that had been pre-treated with 3-Aminopropylthiethoxysilane (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2022Quote: ... 3) donkey anti-rabbit 488 (1:250, Invitrogen). To visualize immunofluorescence ...
-
bioRxiv - Neuroscience 2023Quote: ... anti-V5 (Invitrogen, #R96025, 1:800, 3 days), anti-cFOS (Abcam ...
-
bioRxiv - Neuroscience 2022Quote: ... NIM was exchanged daily for 3:1-DMEM/F12-medium (3 parts DMEM (Thermo Fisher Scientific, #31966047) and one-part F12 medium (Ham’s F-12 Nutrient Mix ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies) ...
-
bioRxiv - Microbiology 2019Quote: ... Caspase-like activity was measure with CellEvent™ Caspase-3/7 Green Flow Cytometry Assay Kit (Invitrogen), a nucleic acid-binding dye that harbors the caspase-3/7 cleavage sequence ...
-
bioRxiv - Immunology 2021Quote: ... Cells were then resuspended in 10 µM CellEvent Caspase 3/7 activity reporter in PBS (Invitrogen, #C10723) and incubated for 30 minutes at 37 °C ...
-
bioRxiv - Immunology 2019Quote: ... for 1h at 37°C or 2 μM CellEvant CASPASE-3/7 Green detection reagent (Thermo Fisher) for 30 minutes at 37°C ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were passaged every 3-7 days as single cells using TrypLE™ Select CTS™ (Gibco). The ROCK inhibitor Y27632 (Fujifilm ...
-
bioRxiv - Microbiology 2020Quote: ... For detection of effector caspase activity 20 µM CellEvent Caspase 3/7 Green Detection Reagent (ThermoFisher Scientific) was added to the infected cells prior to imaging ...
-
bioRxiv - Cancer Biology 2019Quote: ... Taqman® assays (Supplementary table 3) and QuantStudio™ 7 Flex Real Time PCR system (ThermoFisher, USA), and relative expression levels determined using QuantStudio™ 7 Real Time PCR software.
-
bioRxiv - Neuroscience 2019Quote: ... unc-7 rescue plasmids were made using the Multisite Gateway® 3-Fragment Vector Construction Kit (Invitrogen). A 1078bp mec-4 promoter fragment (as previously used ...
-
bioRxiv - Cell Biology 2021Quote: ... MEF cells were supplemented with CellEvent™ Caspase-3/7 green detection reagent (Life Technologies, Darmstadt, Germany) following manufacturer’s instructions before aldehyde fixation ...
-
bioRxiv - Neuroscience 2023Quote: ... 30 microliters of the apoptosis detection reagent (CellEvent™ Caspase-3/7 Green Detection Reagent, Thermofisher, C10723) was added to each well and the slide returned to the incubator for another 60 minutes ...
-
bioRxiv - Neuroscience 2023Quote: Dead and apoptotic cells were detected using the CellEvent Caspase-3/7 Kit (#C10423, Thermo Fisher Scientific) according to the manufacturer’s recommendations ...
-
bioRxiv - Molecular Biology 2022Quote: ... cells were incubated in 2 μM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, cat no: T3168) at 37°C for 15 min ...
-
bioRxiv - Immunology 2021Quote: ... was added as the secondary antibody at a 1:2000 dilution for 1 h at 37C, followed by adding TMB (3, 3, 5, 5’-tetramethylbenzidine) peroxidase substrate (Thermo Scientific) for about 15 min ...
-
bioRxiv - Cell Biology 2020Quote: ... EndoB1 siRNA 5’-UGUUUAUACGACUUGGAGCUU-3’ and 3’-AAGCUCCAAGUCGUAUAAACA-5’ (Invitrogen), control siRNA (Ambion) ...
-
bioRxiv - Microbiology 2021Quote: ... FluoZin-3 (FluoZin™-3, AM, cell permeant, Thermo Fisher) was added at 1 mM ...
-
bioRxiv - Cell Biology 2023Quote: ... siPALS1 (5’-UUCCUUAUGAUGAACUGGCtt-3’) and siPATJ (5’-CCAGAUACUCACACUUCAGtt-3’, Ambion), siARP2/3 (5’- GGAUUCCAUUGUGCAUCAAtt-3’ ...
-
bioRxiv - Biochemistry 2023Quote: ... DiIC12(3) (1,1’-Didodecyl-3,3,3’,3’-Tetramethylindocarbocyanine Perchlorate) (Invitrogen, D383) was used ...
-
bioRxiv - Developmental Biology 2023Quote: ... mounting 3 dpf embryos in 3% methylcellulose (Thermo Scientific, 258111000). After imaging ...
-
bioRxiv - Microbiology 2020Quote: ... Fungal hyphae were stained with 0.5 mM 4.4-difluoro-5-methyl-4-bora-3a,4a-diaza-s-indacene-3-dodecanoic acid (C1-BODIPY 500/510 C12, Thermo Fisher Scientific) or 4.4-difluoro-5,7-dimethyl-4-bora-3a,4a-diaza-s-indacene-3-hexadecanoic acid (BODIPY FL C16 ...
-
bioRxiv - Cell Biology 2020Quote: ... 5 micromols sodium sulfo-NHS and 5 micromols 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC) (Thermo Fisher #22980) in 10 μL of DMSO ...
-
bioRxiv - Bioengineering 2021Quote: ... Celsus Laboratories) was reacted with peptide-hydrazides using 1-ethyl-3-[3-dimethylaminopropyl] carbodiimide hydrochloride (EDC, ThermoFisher Scientific) in 0.1 M MES [2-(N-morpholino)ethanesulfonic acid] buffer with 8 M urea (Sigma ...
-
bioRxiv - Immunology 2020Quote: ... and 50 µL of 50 mg/mL 1-ethyl-3-[3-dimethyl-aminopropyl]-carbodiimidehydrochloride (Thermo Fisher Scientific, 22981) were simultaneously added to the reaction tubes ...
-
bioRxiv - Biochemistry 2020Quote: ... 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride (EDC) and N-hydroxysulfosuccinimide (Sulfo-NHS) were obtained from Thermo Fisher Scientific (Waltham ...
-
bioRxiv - Immunology 2023Quote: ... 4.0 × 107 beads were activated with 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC, Thermo Fisher Scientific [TFS] 22980) and N-hydroxysuccinimide (NHS ...
-
bioRxiv - Cell Biology 2024Quote: ... 4.0 × 107 beads were activated with 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC, Thermo Fisher Scientific [TFS] 22980) and N-hydroxysuccinimide (NHS ...
-
bioRxiv - Developmental Biology 2022Quote: ... 3% FBS (Gibco), 1% MEM non-essential amino acids (Gibco) ...
-
bioRxiv - Genomics 2019Quote: ... 3 (Applied Biosystems).
-
bioRxiv - Microbiology 2021Quote: ... DiOC2(3) (Invitrogen) was added to a final concentration of 30µM or DiSC3(5 ...
-
bioRxiv - Cancer Biology 2022Quote: ... 3% FBS (Invitrogen), 20 ng ml−1 EGF (Peprotech ...
-
bioRxiv - Cell Biology 2020Quote: ... SUMO2/3 (Invitrogen), β-catenin (BD Transduction Laboratories) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 3 (Applied Biosystems). We assembled forward and reverse reads using the Geneious (https://www.geneious.com ...
-
bioRxiv - Neuroscience 2023Quote: ... 3% FBS (Gibco), 0.1mM MEM-NEAA (Gibco) ...
-
bioRxiv - Plant Biology 2020Quote: ... on 4-16% (Figures 4A and 7) or 3-12% (Figures 4C and 6) NativePAGE gels (Life technologies). Cathode Running buffer (Life technologies ...
-
bioRxiv - Synthetic Biology 2019Quote: ... 1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine-N-(7-nitro-2-1,3-benzoxadiazol-4-yl) was purchased from Invitrogen. Calcein dye ...
-
bioRxiv - Bioengineering 2021Quote: ... Apoptosis was detected by incubating devices with 5μM of CellEvent™Caspase 3/7 Green detection reagent (Invitrogen) for 30 minutes at 37°C.
-
bioRxiv - Cancer Biology 2021Quote: ... After 3 and 7 days of treatment cells were stained with 2% crystal violet (CV) (40583100, Acros Organics, Fisher Scientific ...
-
bioRxiv - Immunology 2020Quote: ... splenic NP366-374 TMEM were assessed with CellEvent™ Caspase-3/7 Green Flow Cytometry Assay kit (ThermoFisher). Lung single cells were stained with surface markers then incubated with caspase 3/7 green detection reagent for 30 minutes at 37°C as described in the manufacturer’s instructions ...