Labshake search
Citations for Thermo Fisher :
401 - 450 of 10000+ citations for 7 8 DIHYDRO 1 3 DIOXOLO 4 5 G ISOQUINOLIN 5 6H ONE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... Coomassie NativePAGE 5% G-250 Sample Additive (Thermo Fisher Scientific, #BN2004) was combined to 1/4th the final protein concentration in the supernatant ...
-
bioRxiv - Microbiology 2023Quote: ... 10 μg/mL gentamicin and 5 g/L Albumax I (Gibco). Cultures were incubated at 37 °C in a 5% CO2 incubator and were synchronized by treatment with 5% (w/v ...
-
bioRxiv - Microbiology 2021Quote: ... Paris) and pCMV-VSV-G at a ratio of 4:3:1 with Lipofectamine 3,000 (Thermo Fisher Scientific). Supernatants were collected 48 h after transfection ...
-
bioRxiv - Physiology 2022Quote: ... The samples were combined with 1 ml of 3:13 dilution of Erlich’s reagent [1.5 g of 4- (dimethylamino) benzaldehyde (ThermoFisher); 5 ml ethanol ...
-
bioRxiv - Microbiology 2020Quote: ... 4 μl of 5 mg/ml linear acrylamide (Ambion), 600 μl of preheated (65°C ...
-
bioRxiv - Cell Biology 2022Quote: ... and Ca2+-indicator Fluo-4/AM (5 μM, Invitrogen) in the presence of Pluronic F-127 (0.02% ...
-
bioRxiv - Biochemistry 2021Quote: ... Hi-5 cells (BTI-TN-5B1-4) (Gibco #B85502) were cultured in Express Five™ SFM (Serum-Free Media ...
-
bioRxiv - Cancer Biology 2022Quote: ... 4) Opal 620/anti-TdT (1:8, SEN28, Invitrogen), 5 ...
-
bioRxiv - Biophysics 2023Quote: ... the tissue was incubated for 5 min with 1 µM TO-PRO-3 iodide (Invitrogen, Life Technologies Corporation ...
-
bioRxiv - Molecular Biology 2023Quote: ... 7 μL of Dynabeads Protein G (Invitrogen) was added to the mixture and incubated at 4ºC for 40 min ...
-
bioRxiv - Bioengineering 2020Quote: ... The cells were passaged at a density of 1:2 to 1:8 after reaching ~80% confluency by detaching with 5 mM EDTA in PBS (Invitrogen 15575-038 diluted in sterile 1X PBS ...
-
bioRxiv - Molecular Biology 2022Quote: ... 4ºC) and incubated with 50 μL of 5 μM DAF-FM (4-amino-5methylamino-2’,7’-dichlorofluorescein diacetate, Life Technologies, Eugene, OR, USA) diluted in 1X PBS for 30 min at 34 °C ...
-
bioRxiv - Physiology 2021Quote: ... HUVECs were washed 2 × with D-PBS and loaded with DAF-FM™ diacetate (4-amino-5-methylamino-2′,7′-difluorofluorescein diacetate; Molecular Probes, Invitrogen) to a final concentration of 1 µM in KRH buffer and incubated at 37°C for 45 minutes protected from light ...
-
bioRxiv - Cancer Biology 2024Quote: ... and resolved on 3-8% or 4-12% gradient SDS-PAGE gels (Invitrogen, NuPAGE). After transfer to a polyvinylidene difluoride (PVDF ...
-
bioRxiv - Cell Biology 2023Quote: ... For nuclear staining 0.5µg/µL of DAPI (4’, 6-diamidino-2-phenylindole, dihydro-chloride, Invitrogen. Cat. No.: D3571) was added along with secondary antibody ...
-
bioRxiv - Cancer Biology 2023Quote: ... CellEvent caspase-3/7 green detection reagent (C10423; Invitrogen; 1:1000) was used to measure apoptosis ...
-
bioRxiv - Genetics 2019Quote: ... The Tmem98 open reading frame without the initiating ATG was amplified by PCR using primers 5’-CACCGAGACTGTGGTGATCGTCG-3’ and 5’-AATGGCCGACTGTTCCTGCAG-3’ and cloned into pENTR™/D-TOPO™ (Thermo Fisher Scientific) and subsequently into pcDNA™6.2/N-EmGFP-DEST (Thermo Fisher Scientific ...
-
bioRxiv - Genetics 2019Quote: ... The Tmem98 open reading frame with the initiating ATG was amplified by PCR using the primers 5’-CACCATGGAGACTGTGGTGATCGTCG-3’ and 5’-AATGGCCGACTGTTCCTGCAG-3’ and cloned into pENTR™/D-TOPO™ (Thermo Fisher Scientific) and subsequently into pcDNA™-DEST40 (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2020Quote: 20ng of DNA was amplified for PSEN1-Exon6 using forward (5’ GGTTGTGGGACCTGTTAATT 3’) and reverse (5’ CAACAAAGTACATGGCTTTAAATGA 3’) primers with AmpliTaq Gold® 360 PCR Master Mix (Thermofisher, Waltham, MA, USA). Sanger sequencing was performed using BigDye™ Terminator v3.1 Cycle Sequencing Kit (Thermofisher ...
-
bioRxiv - Developmental Biology 2022Quote: ... or DNAH9 (Primer; Sense: 5’-ACAGGCTGGTGCTGCAGGA-3’, SP6-antisense: 5’-gcgatttaggtgacactatagCAAAATGACGCTGGAGGGG-3’) using the mMESSAGE mMACHINE™ SP6 Transcription Kit (Invitrogen, ThermoFisher Scientific, MA, USA) and a dig-dNTP mix (Roche ...
-
bioRxiv - Neuroscience 2019Quote: ... 9600 thermocycler using TAAR1 specific primers (Forward 5’ CCTGATTATGGATTTGGGAAAA 3’ Reverse 5’ TCATAAAGGTCAGTACCCCAGA 3’) using Amplitaq gold 360 (Applied Biosystems, Foster City, CA, USA). DNA sequencing was performed using ABI BigDye v3.1 cycle sequencing reagents and analyzed on an ABI 3130XL Genetic Analyzer ...
-
bioRxiv - Neuroscience 2022Quote: ... was amplified with specific primers (forward 5’-agtcagaattcatggtgcccactggccag-3’and reverse 5’-AGTCAGGATCCTCAAGCCTTGGCTTCGACTCTT −3’) with fast digest restriction enzymes EcoRl (FD0274, Thermo Fisher Scientific, Massachusetts, USA) and BamHI (FD0054 ...
-
bioRxiv - Cell Biology 2020Quote: Dried fractions were resuspended in 8 μL 5% ACN + 5% FA and analyzed on an Orbitrap Fusion with in-line Easy Nano-LC 1000 (Thermo Scientific). Fractions were run as 3 h gradients progressing from 3% ACN + 0.125% FA to 100% ACN + 0.125% FA ...
-
bioRxiv - Cell Biology 2022Quote: Dictyostelium discoideum cells were maintained in Hans’ enriched HL-5 media (1.4X HL-5 media with 8% FM, penicillin and streptomycin) at 22°C in petri dishes (Fisher Scientific; FB0875712). A full list of strains used in this study can be found in Appendix Table S3.
-
bioRxiv - Physiology 2022Quote: ... An aliquot of 100 μL was subsequently derivatized using a final concentration of 10 mM aniline and 5 mM 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDC) (ThermoFisher) for 2 h at 4 °C ...
-
bioRxiv - Molecular Biology 2020Quote: ... whole cell lysate was collected by centrifugation at 13,000 × g for 15 min at 4 °C and treated with 5 U/ml RNase T1 (Thermo Fisher Scientific) and Turbo DNase (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2022Quote: ... then the supernatant was diluted 10x and pre-cleared for 30 min at 4 °C with rotation using 5 µl protein A- and G-coupled dynabeads (ThermoFisher Scientific). An input sample was taken ...
-
bioRxiv - Molecular Biology 2022Quote: ... Cell lysates were cleared by centrifugation at 16,000 × g for 5 min at 4°C and protein concentration was determined using the Pierce BCA protein assay kit (Thermo Scientific). Cell lysates were mixed with Laemmli sample buffer (Alfa Aesar ...
-
bioRxiv - Immunology 2023Quote: ... cells were pelleted at 100 x g for 5 min (4°C) and then again digested with TrypLE Express Enzyme (Gibco, 12604013) for 15 min at 37°C ...
-
bioRxiv - Microbiology 2023Quote: ... 20% volume of 1M 2-morpholin-4-ylethanesulfonic acid (MES) pH 5 and Immobilized Protein G resin (Thermo Scientific Prod#20397) were added to supernatant and sample was incubated overnight at 4°C ...
-
bioRxiv - Biochemistry 2020Quote: ... 0.5-1.0 mg of cell lysate was incubated with 2-4 µg of antibody for 1 h followed by incubation with 8-10 µl of Protein G agarose (Thermo Fisher) for another 30-45 min ...
-
bioRxiv - Cell Biology 2019Quote: ... Caspase-3/7 activation in live cells was monitored using CellEvent Caspase-3/7 Green Detection Reagent (Thermo Fisher Scientific, C10423, 1:1000) in IncuCyte Live Cell Analysis System ...
-
bioRxiv - Molecular Biology 2020Quote: ... Rabbit antibody to pSMAD 1/5/8 (1:100; CST 9516) and mouse antibody to beta-amyloid (1:100; Invitrogen 13-200) were diluted in the same 3% blocking buffer and incubated overnight at 4°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μM of oligonucleotide labeled with 6-carboxyfluorescein (6-FAM) at the 5’ end (5’– AACGACGGCCAGTGAATCCGTAATCATGGT–3’, Invitrogen), 50 μM each dNTP ...
-
bioRxiv - Neuroscience 2019Quote: ... incubation for 3-5’ in 3,3’ diaminobenzidine (DAB, Acros Organics) staining solution (0.025% w/v DAB ...
-
bioRxiv - Neuroscience 2020Quote: ... 5’-GCCTCCCATCCACAAGAATAGTG-3’ and cloned into pCRII-Blunt-TOPO (Invitrogen). This plasmid was then used to generate digoxigenin-labeled sense and antisense probes.
-
bioRxiv - Immunology 2021Quote: ... ENV probe (5’-/VIC/CCTTGGGTTCTTGGGA-3’/MGB, Thermo Fisher Scientific), Gag forward (5’-ATGTTTTCAGCATTATCAGAAGGA-3’) ...
-
bioRxiv - Immunology 2021Quote: ... Pol probe (5’-/NED/AAGCCAGGAATGGATGGCC-3’/MGB, Thermo Fisher Scientific). Thermostabe DNA polymerase was made in-house by transforming E ...
-
bioRxiv - Molecular Biology 2020Quote: ... a control scrambled RNA (customed, Ambion, sense: 5’-UUCUCCGAACGUGUCACGUtt-3’) was used ...
-
bioRxiv - Cell Biology 2020Quote: ... 3-5 minute incubation with Tryple Express Trypsin (Thermo Fisher), and dilution and gentle trituration in complete media ...
-
bioRxiv - Immunology 2021Quote: ... tetramethylindocarbocyanine perchlorate;CILC18(3) (5 µM/mL DiI, ThermoFisher-Invitrogen) and adoptively transferred intravenously into non-myeloablated Lyve1-GFP+ mice ...
-
bioRxiv - Immunology 2021Quote: ... tetramethylindocarbocyanine perchlorate;CILC18(3) (5 µM/mL DiI, ThermoFisher-Invitrogen) and adoptively transferred intravenously into non-myeloablated Lyve1-GFP+ mice ...
-
bioRxiv - Cell Biology 2020Quote: ... TPD53: 5’-GUCUCCAGCAAUAGGAUGAUUUACUA-3’) with Lipofectamine 2000 (Thermo Fisher Scientific) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2021Quote: ... and removed by treatment with 3-5 mL trypsin (Gibco) then pelleted by centrifugation at 300 × g for 10 min ...
-
bioRxiv - Microbiology 2024Quote: ... 5’- UUUCCUUCCACUCGGAUAAGAUGCUGA-3’ were transfected with RNAiMaX (Thermo Fisher Scientific) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2022Quote: ... brain slices were washed (5 min at RT x 3 times) in PBS and incubated (overnight at 4°C) with streptavidin-Alexa 488 (ThermoFisher Scientific, S-11223, 1:500) in PBS-triton 0.05% ...
-
bioRxiv - Molecular Biology 2021Quote: ... falciparum Dd2 was cultured at 2-5% hematocrit in O+ erythrocytes in Malaria Culture Medium (MCM): RPMI 1640 supplemented with 5 g/L Albumax II (Gibco), 0.12 mM hypoxanthine (1.2 mL 0.1M hypoxanthine in 1 M NaOH) ...
-
bioRxiv - Cancer Biology 2023Quote: ... supplemented with 5% fetal bovine serum (FBS) and 1% antibiotics (penicillin G/streptomycin; Gibco, Waltham, MA, USA) in a humidified atmosphere containing 5% CO 2 at 37 °C.
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 2-(N-[7-nitrobenz-2-oxa-1, 3-diazol-4-yl] amino)-2-deoxyglucose (2-NBDG) (Molecular Probes-Invitrogen, CA, USA) was used to assess glucose uptake in L6 cells ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 2-(N-[7-nitrobenz-2-oxa-1, 3-diazol-4-yl] amino)-2-deoxyglucose (2-NBDG) (Molecular Probes-Invitrogen, CA, USA) was used to assess glucose uptake in L6 cells ...