Labshake search
Citations for Thermo Fisher :
401 - 450 of 10000+ citations for 6H dibenz C E 1 2 oxaphosphorin 6 oxide since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: The purified JEV structural proteins (C, M, E, ED III) from the S2 insect expression system (Invitrogen) were quantified by using the bicinchoninic acid (BCA ...
-
bioRxiv - Bioengineering 2023Quote: ... All samples were then incubated with 4′,6-Diamidino-2-phenylindole (DAPI, 2 µM, Thermofisher) as a nuclear counterstain and Alexafluor 555 phalloidin (1:60 ...
-
bioRxiv - Biochemistry 2022Quote: ... with a N-terminal FLAG-tag and a C-terminal 6×His-tag preceded by a two-residues linker were subcloned into pFastBac 1 vector (Gibco). Sequence transposition into bacmid DNA using DH10Bac cells (Gibco ...
-
bioRxiv - Microbiology 2020Quote: ... were removed from the final pool using a 2% E-gel size-select II (ThermoFisher). Quality of the pool was assessed with the Bioanalyzer DNA 1000 chip (Agilent Technologies ...
-
bioRxiv - Synthetic Biology 2020Quote: ... PCR products were then run on E-Gels EX 2% Agarose (Cat# G402002) from Invitrogen and amplicons of about 586 bp were extracted using the Qiagen QIAquick Gel Extraction Kit (Cat# 28706) ...
-
bioRxiv - Developmental Biology 2022Quote: ... Libraries were then run on an E-Gel EX 2% agarose gel (Cat. # G402022, Invitrogen) for 10 min using the E-Gel Power Snap Electrophoresis System (Invitrogen) ...
-
bioRxiv - Bioengineering 2022Quote: ... All PCR products were validated using E-Gel EX-Gels with 2% Agarose (Thermo Fisher).
-
bioRxiv - Genomics 2022Quote: ... Libraries were then run on an E-Gel EX 2% agarose gel (Cat. # G402022, Invitrogen) for 10 min using the E-Gel Power Snap Electrophoresis System (Invitrogen) ...
-
bioRxiv - Genomics 2022Quote: ... we fill the sample wells of a 2% E-Gel EX Agarose Gels (ThermoFisher G401002) with 16 µL of Ultrapure water and 4 µL of qPCR reaction ...
-
bioRxiv - Molecular Biology 2023Quote: ... libraries were size-selected from 200–400 bp on a 2% agarose E-gel (Invitrogen) and extracted using a MinElute Gel DNA extraction kit (Qiagen ...
-
bioRxiv - Molecular Biology 2023Quote: ... The average size of gDNA was determined using E-Gel SizeSelect 2% agarose gel (Invitrogen) with a 1 kb ladder ...
-
bioRxiv - Immunology 2023Quote: ... The pooled product was then gel purified from a 2% E-gel EX (Life Technologies) using the QIAquick Gel Extraction Kit (Qiagen) ...
-
bioRxiv - Immunology 2023Quote: ... The pooled product was then gel purified from a 2% E-gel EX (Life Technologies) using the QiaQuick Gel Extraction kit (Qiagen) ...
-
bioRxiv - Bioengineering 2023Quote: ... RNA integrity was confirmed by gel electrophoresis on E-gel EX 2% agarose gels (Thermofisher).
-
bioRxiv - Developmental Biology 2023Quote: ... Libraries were size-selected using the E-Gel EX 2% agarose gel (Cat. # G402022, Invitrogen) and the E-Gel Power Snap Electrophoresis System (Invitrogen) ...
-
bioRxiv - Developmental Biology 2024Quote: ... Samples were then gel purified and size selected using E-gel EX 2% Agarose (Invitrogen) and was followed by gel extraction (Qiagen) ...
-
bioRxiv - Developmental Biology 2024Quote: ... Samples were then gel purified and size selected using E-gel EX 2% Agarose (Invitrogen) followed by gel extraction (Qiagen).
-
bioRxiv - Neuroscience 2019Quote: ... Nuclei were counterstained with 4’,6-diamidino-2-phenylindole (DAPI, 1:5000 in PBS) (Molecular Probes, Eugene, OR). The TUNEL stain signal was observed under an FV300 confocal microscope (Olympus Optical Company ...
-
bioRxiv - Microbiology 2021Quote: ... with SARS-CoV-2 N-specific primers (EV Table 1) on a QuantStudio 6 Flex thermocycler (Applied Biosystems). Standard curve was performed in parallel using purified SARS-CoV-2 viral RNA ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... and 6 μg of pcDNA-SARS-CoV-2-S(ΔC19) in 1 ml of Opti-MEM medium (ThermoFisher). Then ...
-
bioRxiv - Immunology 2020Quote: ... Cells were then stained with 1 μg/mL 4′,6-diamidino-2-phenylindole (DAPI; Molecular Probes/Thermo Fisher) and analysed on a FACSVERSE (BD Biosciences) ...
-
bioRxiv - Immunology 2020Quote: ... Cells were then stained with 1 μg/mL 4′,6-diamidino-2-phenylindole (DAPI; Molecular Probes/Thermo Fisher) and analysed on a FACSVERSE (BD Biosciences) ...
-
bioRxiv - Physiology 2020Quote: ... DAPI (4’,6-Diamidino-2-Phenylindole Dihydrochloride; 1:2000 diluted in PBTD; Thermo Fisher Scientific, Stockholm, Sweden; 62248) was added for 3 minutes followed by washing in PBTD for 25 minutes and mounting with ProLong gold antifade reagent (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2021Quote: ... slices were counterstained with 4’,6-diamidine-2’-phenylindole 502 dihydrochloride (DAPI, D3571, Molecular Probes; dilution 1:1000) for 5 minutes followed by 2 minutes wash in PBS ...
-
bioRxiv - Cell Biology 2022Quote: ... Nuclei were counterstained using 4′,6-diamidin-2-phenylindol (DAPI, 1:1000, 7 min; D1306, Thermo Fisher Scientific). Washing steps were performed with PBS ...
-
bioRxiv - Bioengineering 2022Quote: ... the cell nuclei were stained with 1 μg/mL 4’,6-diamidino-2-phenylindole (DAPI, ThermoFisher Scientific #62248) in DPBS for 15 min at room temperature ...
-
bioRxiv - Neuroscience 2023Quote: ... Slices were either washed using DAPI (4’,6-Diamidino-2-Phenylindole, Dihydrochloride; 1:10000; Thermo Fisher Scientific, MA) made up in di H2O to stain for nuclei before being mounted or cover-slipped with ProLong Gold mounting medium with DAPI (Fisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... and counterstained with 4′,6-diamidin-2-phenylindole (DAPI, 4 μg mL-1, Thermo Fisher Scientific, MA, USA). From the 18 biofilms from each year ...
-
bioRxiv - Cell Biology 2023Quote: ... Nuclei were stained by incubation with 0.5 – 1 µg/mL 4’,6-diamidino-2-phenylindole (DAPI, D1306, Invitrogen) in PBS for 10 min at RT ...
-
bioRxiv - Biophysics 2023Quote: ... in 3% BSA with a 1:50 ratio and 4’,6-diamidino-2-phenylindole (DAPI, Thermo Fisher Scientific) were employed ...
-
bioRxiv - Physiology 2023Quote: ... slides were stained with 1:10,000 DAPI (4’,6-diamidino-2-phenylindole, Thermo Fisher Scientific; Cat. No.: D3571) for 10 min at room temperature before coverslips were applied with PBS and glycerol (1:1 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Inoculated cells were incubated for 1 h at 37°C and then overlaid with a 1:1 mixture of 1.2% Oxoid agar and 2× DMEM (Gibco) with 10% (vol/vol ...
-
bioRxiv - Microbiology 2020Quote: ... incubated at 37°C (Cytomat 2, Thermo Scientific) with continuous shaking and OD595nm was measured every 30 min for 16 h in a Filtermax F5 multimode plate reader (Molecular Devices) ...
-
bioRxiv - Cell Biology 2020Quote: ... For cycloheximide treatment began 6h before cells were washed twice with cysteine/methionine-free DMEM (Thermo Fisher Scientific, 21013024), incubated in 2ml of cysteine/methionine-free DMEM ...
-
bioRxiv - Microbiology 2021Quote: ... Cells were washed 6h post transfection and grown for an additional 72-96h in serum-free Optipro medium (Invitrogen) supplemented with glutamine and non-essential amino acids ...
-
bioRxiv - Immunology 2019Quote: ... adult females aged 6 to 11 days after eclosure were injected with fluorescent bioparticles (E. coli K-12 Strain Bioparticles TexasRed Conjugate; Invitrogen) or pH sensitive fluorescent bioparticles (pHrodo E ...
-
bioRxiv - Neuroscience 2020Quote: ... 100-µl drop of 0.5% low-melting agarose (FMC, Fig. 1D,E, Fig. S1G) containing a 6:7 ratio of spinal cord medium [MEM with Glutamax (Gibco) supplemented with 4 mg/ml Albumax (Gibco) ...
-
bioRxiv - Neuroscience 2019Quote: ... frozen brains from C57BL/6 WT or Prnp0/0 (PrP-KO) mice 43 were gently chopped in few drops of Hibernate-E (Gibco) and transferred to a 15 mL tube containing 75 U/ml of collagenase type III (Worthington ...
-
bioRxiv - Developmental Biology 2022Quote: ... The 6 μm thickness section was prepared on the Microm HM 340 E rotary microtome (Thermo Scientific, Waltham, MA, USA), and dewaxed in xylene and serial concentrations of ethanol before staining ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Several donor colonies and one recipient colony were independently inoculated in 2 mL of LB in 15-mL tubes and cultured for 6 hours (37°C and 250 rpm, Thermo Scientific™ MaxQ™ 8000). Cultures were centrifuged (15 minutes ...
-
bioRxiv - Immunology 2021Quote: ... with an N-terminal IL-2 signal peptide for secretion and a C-terminal 6×His tag for purification was inserted into pFUSE-vector (Invitrogen, Thermo Fischer Scientific, MA, USA). The human ACE2 was expressed by essentially the same protocol used for the COVID-19 RBD ...
-
bioRxiv - Physiology 2023Quote: ... IL-6 and FFA content were measured by ELISA (IL-1β, Biolegend, 432604; IL-6, Invitrogen, BMS603-2) or a FFA fluorometric kit (Cayman Chemical ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μM of oligonucleotide labeled with 6-carboxyfluorescein (6-FAM) at the 5’ end (5’– AACGACGGCCAGTGAATCCGTAATCATGGT–3’, Invitrogen), 50 μM each dNTP ...
-
bioRxiv - Zoology 2023Quote: ... stained with 4′,6-diamidino-2-phenylindole (DAPI) (1:2000 dilution) and Alexa Fluor-conjugated donkey-anti-mouse (Molecular Probes, 1:1000), in PBST at room temperature for 2 hours ...
-
bioRxiv - Zoology 2024Quote: ... Tissue samples were subsequently rinsed three times with DPBS again and then transferred onto microscope slides in mounting buffer containing 1:1 DPBS: glycerol and 1µg/mL 4’,6-diamidino-2-phenylindole dihydrochloride (DAPI) (Molecular Probes, Eugene, OR) to stain cell nuclei in prepared tissues and examined under a Lumen Dynamics XCite™ 120Q Nikon fluorescence microscope (Nikon ...
-
bioRxiv - Cell Biology 2021Quote: ... Final dehydration was performed by 100% propylene oxide (PrOx, ThermoFisher (Kandel) GmbH ...
-
bioRxiv - Neuroscience 2022Quote: ... Serotonin creatine sulfate monohydrate from Sigma (H7752-5G) and Clozapine N-oxide dihydrochloride (CNO) from Fisher Scientific (sourced from Tocris Bioscience (6329/10) ...
-
bioRxiv - Neuroscience 2023Quote: ... containing five zirconium ceramic oxide beads (1.4-mm diameter, Fisher Scientific). Then 50 μL of the deuterated internal standards (progesterone-d9 ...
-
bioRxiv - Cell Biology 2021Quote: ... Jackson) at 37 °C for 2 h and the Hoechst 33342 (1:200, H3570, Life Technologies) to label DNA ...
-
bioRxiv - Immunology 2020Quote: ... then labelled with 2’,7’-bis-(2-carboxyethyl)-5-(and-6)-carboxyfluoresceinacetoxymethyl ester (Life Technologies, UK). Neutrophils were then added to wells under normoxia or hypoxia ...