Labshake search
Citations for Thermo Fisher :
51 - 100 of 10000+ citations for 6 aminonaphthalene 1 3 disulphonic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... and passaged every 4-6 days with 0.5mM ethylenediaminetetraacetic acid (EDTA, Invitrogen 15575020) in Dulbecco’s Phosphate-Buffered Saline (DPBS ...
-
bioRxiv - Cell Biology 2022Quote: ... worms were transferred to bacteria-seeded plates containing 1 mM indole-3-acetic acid (Acros Organics, Cat #122160250) and incubated for the indicated time periods before analysis.
-
bioRxiv - Microbiology 2019Quote: ... 2 mM 3-methyl-2-oxobutanoic acid (Fisher Scientific, Hampton, NH) and 1 mM acetyl-CoA (Sigma-Aldrich ...
-
bioRxiv - Molecular Biology 2022Quote: ... Indole-3-acetic acid (IAA) was purchased from ThermoFisher (Product #I3750). IAA treatment was performed as previously described (Zhang et al ...
-
bioRxiv - Biophysics 2023Quote: ... 3-(N-morpholino)propanesulfonic acid) (MOPS) was purchased from Acros Organics. Texas Red DHPE (TR-DHPE) ...
-
bioRxiv - Cancer Biology 2021Quote: ... Culture medium was refreshed every 2–3 days and organoids were passaged 1:2–1:6 every 7–21 days using TrypLE Express (Thermo Fisher). For co-culturing ...
-
bioRxiv - Biophysics 2019Quote: ... 4-(2-(6-(dibutylamino)-2-naphthalenyl)ethenyl)-1-(3-sulfopropyl)-,hydroxide (di-4-ANEPPS) was purchased from Invitrogen. It was dissolved in ethanol and added to the dried lipid film at a 12:1 lipid:probe molar ratio ...
-
bioRxiv - Neuroscience 2020Quote: Neocortex from C57Bl/6 pups (postnatal day 1-3) was dissected in Hibernate-A medium (#A1247501, Gibco, USA), digested with papain (#LS003124 ...
-
bioRxiv - Biophysics 2023Quote: ... in 3% BSA with a 1:50 ratio and 4’,6-diamidino-2-phenylindole (DAPI, Thermo Fisher Scientific) were employed ...
-
bioRxiv - Neuroscience 2023Quote: ... DAPI (4′,6-diamidino-2-phenylindole, 3 uM final) (Invitrogen, D1306) was used to stain the DNA content of cells so that doublets and debris could be removed by sorting on the DAPI height vs DAPI area ...
-
bioRxiv - Genomics 2021Quote: ... and then blocked for 1 hour with 1 ml of blocking buffer (wash buffer containing 3% fatty acid free BSA (Thermo Fisher, 126609)) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μM of oligonucleotide labeled with 6-carboxyfluorescein (6-FAM) at the 5’ end (5’– AACGACGGCCAGTGAATCCGTAATCATGGT–3’, Invitrogen), 50 μM each dNTP ...
-
bioRxiv - Developmental Biology 2020Quote: ... 1% nonessential amino acids (Invitrogen), 0.1mM β-mercaptoethanol (Sigma) ...
-
bioRxiv - Developmental Biology 2020Quote: ... 1% nonessential amino acids (Invitrogen), 1% Sodium-pyruvate (BI 03-042-1B) ...
-
bioRxiv - Biochemistry 2020Quote: ... span)/1‰ formic acid (Fisher Scientific), phase B ...
-
bioRxiv - Cell Biology 2021Quote: ... 1% nonessential amino acids (Gibco) and supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Microbiology 2021Quote: ... 1% nonessential amino acids (Invitrogen), 100 μg/mL of streptomycin (Invitrogen) ...
-
bioRxiv - Microbiology 2020Quote: ... 1% nonessential amino acids (Gibco), 2% tryptose phosphate broth (Sigma) ...
-
bioRxiv - Microbiology 2019Quote: ... 1% nonessential amino acids (Invitrogen) and 1% penicillin (Invitrogen) ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1% nonessential amino acids (Gibco), 2 mM L-glutamine and 1,000 U/mL leukaemia inhibitory factor (LIF ...
-
bioRxiv - Biophysics 2019Quote: ... 1% nonessential amino acids (Gibco), 2 mM sodium pyruvate (Gibco) ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1× nonessential amino acids (Gibco), 1× sodium pyruvate (Gibco ...
-
bioRxiv - Biochemistry 2020Quote: ... Spain)/1‰ formic acid (Fisher Scientific), phase B ...
-
bioRxiv - Cancer Biology 2021Quote: ... 1% nonessential amino acids (Gibco), 1% penicillin/streptomycin (Gibco) ...
-
bioRxiv - Microbiology 2021Quote: ... 1% nonessential amino acids (Gibco), 1% HEPES (Gibco) ...
-
bioRxiv - Developmental Biology 2022Quote: ... 1× nonessential amino acids (Gibco), 0.1 mM β-mercaptoethanol (Gibco) ...
-
bioRxiv - Microbiology 2022Quote: ... 10 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) (Gibco), 100 U/ml penicillin–100 μ/ml streptomycin ...
-
bioRxiv - Biochemistry 2023Quote: ... Spain)/1‰ formic acid (Fisher Scientific), phase B ...
-
bioRxiv - Molecular Biology 2023Quote: ... nonessential amino acids (1%; Invitrogen), trace elements (1% ...
-
bioRxiv - Cancer Biology 2023Quote: ... 1% nonessential amino acids (Gibco). Tamoxifen resistant (TamR ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1% nonessential amino acids (Gibco), 1mM sodium pyruvate (Gibco) ...
-
bioRxiv - Immunology 2024Quote: ... 1% nonessential amino acids (Invitrogen), 1% sodium pyruvate (Invitrogen) ...
-
bioRxiv - Immunology 2024Quote: ... 1% nonessential amino acids (Invitrogen), 1% sodium pyruvate (Invitrogen) ...
-
bioRxiv - Cell Biology 2023Quote: ... PBS was replaced with a 1:6 (weight: volume) solution of 0.5 M acetic acid (984303; Thermo Fisher, Waltham, MA, USA) with 1 mg/ml pepsin (20343 ...
-
bioRxiv - Physiology 2022Quote: ... The nucleic acids present in the pituitary gland cells were visualised with TOTO-3 (1:2000, Thermo Fisher Scientific). Sections were incubated with TOTO-3 for 15 min on an agitated surface ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies), and parasite burden was calculated based on the standard curve of known parasite contents(24).
-
bioRxiv - Neuroscience 2021Quote: ... neurons were anchored with succinimidyl ester of 6-((Acryloyl)amino) hexanoic acid (AcX) (Thermofisher) in PBS (0.1mg/ml ...
-
bioRxiv - Cell Biology 2022Quote: ... SE (6-((acryloyl)amino)hexanoic acid)-labelled fibronectin (A20770, ThermoFisher Scientific; FC010, EMD Millipore), and polymerized on activated glass coverslips for 1 hr at room temperature ...
-
bioRxiv - Physiology 2020Quote: Acid extracted rat tail Type I Collagen (3 mg/mL; Thermo Fisher) was maintained at 4°C until polymerization ...
-
bioRxiv - Cell Biology 2021Quote: ... embryos at the 3-6 somite stage were embedded oriented laterally in 1% low-melt agarose (Invitrogen, Carlsbad, CA) and imaged under bright field (to determine yolk elongation by taking major and minor axis measurements ...
-
bioRxiv - Developmental Biology 2022Quote: ... and passaged very 3-4 days with a 1:4-6 passage ratio using Versene solution (Life Technologies 15040066).
-
bioRxiv - Neuroscience 2019Quote: ... harbouring the full-length cDNA coding for the human muscle 6-phosphofructo-1-kinase muscle isoform (PFK1-M)3 (accession number, NM_000289.1) using Lipofectamine LTX-PLUS Reagent (Life Technologies) according with manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... and optiMEM (1:6; Gibco) or were left untreated ...
-
bioRxiv - Immunology 2023Quote: ... post-dose 3 and 6-months post-dose 3 using mouse anti-human IgG1 biotin (Thermo Fisher Scientific) and mouse anti-human IgG4 biotin (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2021Quote: ... using QuantStudio 6 or 3 Flex Real-Time PCR System (Applied Biosystems). SARS-CoV-2 standards with known copy numbers were used to construct a standard curve and calculate copy numbers/mL or copy numbers/g.
-
bioRxiv - Cancer Biology 2021Quote: ... 10 ng/ml IL-6 and 10 ng/ml IL-3 (Gibco). Inpp4b+/+ and Inpp4b-/- LSK were each retrovirally transduced with pMSCV-MLL-AF9-IRES-mVenus ...
-
bioRxiv - Microbiology 2023Quote: ... using QuantStudio 6 or 3 Flex Real-Time PCR System (Applied Biosystems). SARS-CoV-2 standards with known copy numbers were used to construct a standard curve and calculate copy numbers/mL or copy numbers/g ...
-
bioRxiv - Microbiology 2019Quote: ... day 1 (24 hours) and day 3 (72 hours) by staining with SYBR Green 1 nucleic acid stain (Invitrogen, ThermoFisher Scientific, Eugene, OR, USA) at 1:2000 dilution in PBS/0.3% BSA for 20 minutes ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2:6 and 3:6 dilution ratios to allow efficient selection of Hygromycin B (Thermo Fisher Scientific Catalog Number: 10687010). The Hygromycin selection was started at the 48 hours after transfection time point with a final concentration of 150µg/ml and refreshed every 3-4 days until the control non-transfected cells on a separate plate were completely dead (takes approximately 3 weeks from the start of transfection until the cells are expanded and frozen) ...
-
bioRxiv - Cell Biology 2019Quote: ... Slides were washed 3 × 10 min with PBS and nuclei stained with 1 µg/mL 4’,6-diamidino-2-phenylindole (DAPI, Invitrogen) in PBS for 15 min ...