Labshake search
Citations for Thermo Fisher :
1 - 50 of 10000+ citations for 6 aminonaphthalene 1 3 disulphonic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... 12.5 mM 8-aminonaphthalene-1,3,6-trisulfonic acid (ANTS; Molecular Probes, Eugene, ORE, USA) and 45 mM p-xylene-bis-pyridinium bromide (DPX ...
-
bioRxiv - Biophysics 2020Quote: ... 8-Aminonaphthalene-1,3,6-trisulfonate (ANTS) was from Invitrogen Life Technologies (Grand Island ...
-
bioRxiv - Immunology 2023Quote: ... 2,2′-azino-bis-3-ethylbenzothiazoline-6-sulfonic acid solution (Invitrogen, 002024) was added to the wells as the coloring substate for HRP ...
-
bioRxiv - Physiology 2022Quote: ... Mitochondria membrane polarization was measured by loading cells with 2 µM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, 15003) at 37°C for 15 min ...
-
bioRxiv - Microbiology 2023Quote: ... Substrate 2,2’-Azinobis [3-ethylbenzothiazoline-6-sulfonic acid]-diammonium salt (ABTS; Thermo Fisher Scientific) was added ...
-
bioRxiv - Molecular Biology 2022Quote: ... cells were incubated in 2 μM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, cat no: T3168) at 37°C for 15 min ...
-
bioRxiv - Neuroscience 2020Quote: ... Cells were then passaged 1:3-1:6 every 2-3 days using Accutase (Gibco).
-
bioRxiv - Biochemistry 2021Quote: ... 3-[p-(6-phenyl)-1,3,5-hexatrienyl] phenylpropionic acid was purchased from Molecular Probes (Eugene, OR, USA) and 1-stearoyl-2-linoleoyl-sn-glycerol-3-phosphocholine (SLPC ...
-
bioRxiv - Immunology 2020Quote: ... plates were incubated with 2,2’-azino-bis(3-ethylbenzothiazoline-6-sulphonic acid) substrate (ABTS, Thermo Fisher Scientific) for 15 min at RT shielded from light and absorbance was measured at optical density (OD ...
-
bioRxiv - Physiology 2023Quote: ... with or without 0.1uM 6-Hydroxyhexanoic acid (6-HHA, ThermoFisher, B24857.03).
-
bioRxiv - Immunology 2022Quote: ... 3 µl of Dynabeads MyOne Carboxylic Acid (1 μm; ThermoFisher Scientific) were added at a concentration of 0.5 mg/ml to each of the samples ...
-
bioRxiv - Molecular Biology 2020Quote: ... flushed with argon prior to adding hydrochloric acid (3 mL of 6 M sequencing grade solution; Thermo Scientific #PI24308). Sealed tubes were kept at 125° C for 48h (oil bath ...
-
bioRxiv - Microbiology 2022Quote: 3×10^6 S2 cells (Invitrogen)/well were plated on a 6-well plate in Complete Schneider’s media supplemented with 10% FBS and pen/strep (CS10PS) ...
-
bioRxiv - Genomics 2020Quote: ... and 3 mL acid phenol:chloroform (Thermo Fisher). This mixture was heated to 65°C and shaken at 1400 rpm for 10 minutes followed by 5 minutes on ice ...
-
bioRxiv - Immunology 2022Quote: ... and valproic acid (3 mM, Acros Organics) were added to the cells immediately post-transfection to increase recombinant protein production ...
-
bioRxiv - Immunology 2023Quote: ... and valproic acid (3 mM, Acros Organics) were added to the cells immediately post-transfection to increase recombinant protein production ...
-
bioRxiv - Neuroscience 2019Quote: ... 6 mL non essential amino acids (Gibco, Life Technologies), 6 mL 200 mM L-glutamine (Gibco ...
-
bioRxiv - Neuroscience 2019Quote: ... 6 mL non essential amino acids (Gibco, Life Technologies), 6 mL 200 mM L-glutamine (Gibco ...
-
bioRxiv - Immunology 2022Quote: ... and the wells were washed five times with wash buffer before the addition of 2,2’-azino-bis (3-ethylbenzothiazoline-6-sulphonic acid (ABTS, #37615, Thermo Fisher Scientific). Optical density was read 40 min later at 405 nm using a plate reader (SpectraMax i3 ...
-
bioRxiv - Immunology 2022Quote: ... for 3 min and incubated in 1% phosphomolybdic acid then acetic acid solution (A38C-212; Thermo Fisher Scientific, Waltham, MA) for 5 min and 3 min ...
-
bioRxiv - Plant Biology 2019Quote: ... in hydrochloric acid 0.01 N (1:3, v:v) (Fisher Scientific; Hampton, New Hampshire, USA).
-
Chemoproteomics of microbiota metabolites reveals small-molecule agonists for orphan receptor GPRC5AbioRxiv - Biochemistry 2021Quote: ... indole-3-acetatic acid (Fisher Scientific, Catalog #11453194), tryptamine (Sigma-Aldrich ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Slices were finally incubated for 3-6 minutes with DAPI (1:10 000, Invitrogen) diluted in PBS and mounted on Polysine® Slides stored at 4°C until imaging.
-
bioRxiv - Microbiology 2023Quote: Susceptibility to bile salts (cholic acid and deoxycholic acid in a mixture of 1:1, Bile Salts No.3, Thermo Fisher Scientific Inc., Waltham, USA) was tested in two different concentrations ...
-
bioRxiv - Microbiology 2022Quote: ... 6 μM Hoechst 33342 nucleic acid stain (Thermo Fisher Scientific) was added to each well at least 1 hour before images were taken ...
-
bioRxiv - Microbiology 2019Quote: ... and 3-6 μl Lipofectamin 2000 (Life Technologies). See the Supplemental Information for detailed description.
-
bioRxiv - Immunology 2020Quote: ... and QuantStudio 3 or 6 Flex (ThermoFisher Scientific) following manufacturer’s recommendations ...
-
bioRxiv - Genetics 2022Quote: ... TO-PRO-3 Iodide carbocyanine monomer nucleic acid stain (1:1000, Thermo Fisher, cat# T3605) was used to stain DNA ...
-
bioRxiv - Cell Biology 2022Quote: ... For the bulk endocytosis experiments using the 4-[6-[4-(diethylamino)phenyl]-1,3,5-hexatrien-1-yl]-1-[3-(triethylammonio)propyl]-pyridiniumbromide dye (FM 4-64, Invitrogen), the cells were prepared as previously described [41] ...
-
bioRxiv - Developmental Biology 2020Quote: ... sections were rinsed in 3% acetic acid (Fisher Scientific) for 3 minutes and incubated at room temperature for 30 minutes in 1% Alcian Blue 8GX (Sigma-Aldrich ...
-
bioRxiv - Bioengineering 2021Quote: ... and 3-mercaptopropionic acid were purchased from ACROS ORGANICS. Hydrogen tetrachloroaurate(III ...
-
bioRxiv - Developmental Biology 2023Quote: ... acidified to pH2-3 by trifluoroacetic acid (Thermofisher, 85183), and desalted with a Pierce C18 spin column (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2020Quote: ... Parasitemias were determined on day 3 by staining with SYBR Green 1 nucleic acid stain (Invitrogen) at 1:2000 dilution in PBS/0.3% BSA for 20 minutes ...
-
bioRxiv - Microbiology 2019Quote: ... day 1 (24 hours) and day 3 (72 hours) by staining with SYBR Green 1 nucleic acid stain (Invitrogen, ThermoFisher Scientific ...
-
bioRxiv - Neuroscience 2021Quote: ... DiIC18(3) dye (6 mg; Invitrogen, Carlsbad, CA, USA) was dissolved in 99.5% methylene chloride (300 μL ...
-
bioRxiv - Cancer Biology 2020Quote: ... n = 3) or oligopyridylamides (5 µM ADH-1 or ADH-6, n = 3) using a combination of both TriZol (Thermo Fisher Scientific) and RNAeasy Mini Kit (Qiagen ...
-
bioRxiv - Pathology 2024Quote: ... Cells were subcultured at a 1:3 to 1:6 ratio using Gibco TrypLETM Express Enzyme (12605010, Fisher Scientific) for cell dissociation ...
-
bioRxiv - Pathology 2020Quote: ... citric acid (Fisher Scientific, Cat. No. A104-3, Hampton, NH), sodium phosphate (Sigma Aldrich ...
-
bioRxiv - Neuroscience 2020Quote: ... 3 sodium pyruvate and 0.40 L-ascorbic acid (Acros Organics), bubbled to a pH of 7.4 with 5% CO2 in 95% O2 ...
-
bioRxiv - Neuroscience 2023Quote: ... 3 sodium pyruvate and 0.40 L-ascorbic acid (Acros Organics), bubbled with 5% CO2 in 95% O2 ...
-
bioRxiv - Neuroscience 2023Quote: ... 3 sodium pyruvate and 0.40 L-ascorbic acid (Acros Organics), bubbled with 5% CO2 in 95% O2 ...
-
bioRxiv - Bioengineering 2023Quote: ... was reduced on the 78 ± 3 nm cores using 1 ml of 1 mM L-ascorbic acid (AA) (Fisher Scientific), making core@shell structures ...
-
bioRxiv - Immunology 2021Quote: ... mouse interleukin 6 (IL-6; ThermoFisher; 1:500). Sections were then stained for DAPI (Sigma ...
-
bioRxiv - Biochemistry 2019Quote: ... fluorescent probes Prodan (6-propionyl-2[dimethylamino]-naphthalene) and ANS (1-anilinonaphthalene-8-sulfonic acid) were also from Invitrogen; PMB ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies) ...
-
bioRxiv - Cancer Biology 2022Quote: ... the samples were reconstituted in 6 uL 0.1% formic acid (FA) 0.05% heptafluorobutyric acid (HFBA) (Thermo Fisher Scientific, cat. 25003).
-
bioRxiv - Genomics 2019Quote: ... were harvested and placed in 3:1 ethanol:glacial acetic acid fixative and then transferred to fresh 3:1 fixative containing 1% Polyvinyl Pyrrolidone (BP431-100, Fisher Scientific, USA). Emerging anthers from the flower buds were isolated and squashed under a 22 × 22 mm glass cover-slip to provide the best anthers for pachytene analysis ...
-
bioRxiv - Microbiology 2020Quote: ... 6-carboxyfluorescein (FAM)-5= CCG TCA ATC AAG GAG CGC CTC 3=-6 carboxytetramethylrhodamine (TAMRA) (Life Technologies).Viral RNA was detected using the CFX96 detection system (Bio-Rad Laboratories ...
-
bioRxiv - Microbiology 2021Quote: ... 6-carboxyfluorescein (FAM)-5’ CCG TCA ATC AAG GAG CGC CTC 3’-6 carboxytetramethylrhodamine (TAMRA) (Life Technologies).Viral RNA was detected using the CFX96 detection system (Bio-Rad Laboratories ...
-
bioRxiv - Molecular Biology 2020Quote: ... Samples were separated by electrophoresis on a 6% bis-Acrylamide (19:1) gel that was stained overnight with 1X SYBR green I nucleic acid gel stain (Invitrogen). The gel was imaged and quantified using an AlphaImagerHP (Alpha Innotech) ...