Labshake search
Citations for Thermo Fisher :
351 - 400 of 10000+ citations for 6 Methyl benzo 1 3 dioxole 5 carbaldehyde since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... 5’- UUUCCUUCCACUCGGAUAAGAUGCUGA-3’ were transfected with RNAiMaX (Thermo Fisher Scientific) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... total 2 μg was diluted into 6 μl of reagent (1:3 ratio) in the 100 μl of Opti-MEM I medium (31985062, Thermo Fisher Scientific) and incubated for 15 min at RT ...
-
bioRxiv - Bioengineering 2022Quote: ... pools of 10 couples (n=8) were maintained up to 1 month in 6 well plates (9.6 cm2) using 3 mL of M199 (GIBCO, 41150-020, UK), DMEM (GIBCO ...
-
bioRxiv - Neuroscience 2020Quote: ... The sections were rinsed with PBS (3×10min) and incubated for 6 hours with secondary donkey anti-rabbit 488 antibodies (1:1000, ThermoFisher Scientific, A11006) and streptavidin 594 (1:750 ...
-
bioRxiv - Cancer Biology 2022Quote: ... Cells were washed 3 x 5 min and incubated for 10 min with DAPI (1/2000, Invitrogen #D1306) diluted in PBT + 0.5% BSA ...
-
bioRxiv - Microbiology 2022Quote: ... Vero-E6 cells and Calu-3 were treated with 5 μg/ml or 1 μg/ml puromycin (Gibco), respectively ...
-
bioRxiv - Developmental Biology 2023Quote: ... we slowly injected 0.5-1 μL rAAV (about 1∼3×109 genome copy (GC)) mixed with Chicago Sky Blue dye (0.1%, Fisher Scientific, Cat # AAA1424214) into the oviduct ampulla using a glass micropipette with tip diameter of ∼10-30 μm ...
-
bioRxiv - Molecular Biology 2023Quote: ... and lungs were dissected and placed in ice cold FACS buffer (1% BSA, 3% FBS, 96% Ca2+ and Mg2+ free PBS) with 1 μg/ml Actinomycin D (ThermoFisher BP606-5). After isolation ...
-
bioRxiv - Synthetic Biology 2024Quote: ... HEK293FT and HEK293FT-LP cells were subcultured at a 1:5 to 1:10 ratio every 2–3 d using Trypsin-EDTA (Gibco 25300-054). All HEK293FT cell lines generated by engineering either the HEK293FT or HEK293FT-LP parent cell lines were cultured in the same way ...
-
bioRxiv - Cell Biology 2023Quote: ... were seeded on the top of the membrane and cultured for 3 days in DMEM/F12 (1/1) supplemented with 5 % fetal bovine serum (Fetal Clone II; Hyclone, Thermo Scientific, France), 0.2 ng/ml EGF (Gibco) ...
-
bioRxiv - Immunology 2019Quote: ... from RNA extracted from peripheral blood mononuclear cells (PBMCs) utilizing the following primers: forward 5’-GAGAATTCACCATGACTATGGAGACCCAAATG-3’ and reverse 5’-CGTACGCCCCATTGGTGAAGAGCTGCC-3’ (Thermo Fisher Scientific, Waltham, MA, USA). PCR product was fused by restriction enzyme-compatible ends with the CD8α-CD28-CD3ζ domain contained in the pcDNA3.1/V5-His TOPO TA (Invitrogen ...
-
bioRxiv - Developmental Biology 2022Quote: ... or DNAH9 (Primer; Sense: 5’-ACAGGCTGGTGCTGCAGGA-3’, SP6-antisense: 5’-gcgatttaggtgacactatagCAAAATGACGCTGGAGGGG-3’) using the mMESSAGE mMACHINE™ SP6 Transcription Kit (Invitrogen, ThermoFisher Scientific, MA, USA) and a dig-dNTP mix (Roche ...
-
bioRxiv - Immunology 2019Quote: ... from RNA extracted from freshly isolated peripheral blood mononuclear cells (PBMCs) utilizing the following primers: forward 5’-GAGAATTCACCATGACTATGGAGACCCAAATG-3’ and reverse 5’-CGTACGCCCCATTGGTGAAGAGCTGCC-3’ (Thermo Fisher Scientific, Waltham, MA, USA). The PCR product was fused in tandem by restriction enzyme-compatible ends with the CD8α transmembrane domain and the CD28 and CD3ζ intracellular regions already available in the lab (CD32131R-CR) ...
-
bioRxiv - Biochemistry 2023Quote: ... cyriacigeorgica clinical isolate responsible for pulmonary nocardiosis was used as a template for polymerase chain reaction (PCR) with primers 5’- gatatgcaccacggcctgca-3’ and 5’-acggcgacgaagaagcgga-3’ by using Invitrogen™ Platinum SuperFi II DNA Polymerase (Thermo Fisher Scientific, Illkirch, France). A second PCR was performed on the aforementioned amplicon to amplify the truncated version of NCY-1 with the following forward 5’-ggtaccgagaacctgtacttccagggttcggccgtggccgatccccggttcgccgcactggaaacg-3’and reverse 5’- gtggtgctcgagctaaccgagcacgtcgacgaccgtcctggtcgcgtcggc-3’primers ...
-
bioRxiv - Neuroscience 2023Quote: ... At 5-6 dpf each FoxP2.A:FingR(PSD95)+ larva was placed into individual wells of a 6-well plate (Thermo Fisher Scientific) containing approximately 10mL of fish water ...
-
bioRxiv - Biochemistry 2021Quote: ... or with 0.5 µg/ml doxycycline for 2-3 days) were combined in a 1:1 ratio and loaded with 5 µg/ml Indo-1 (Molecular Probes, AAT Bioquest, Sunnyvale, USA) and 0.04% of pluronic F-127 (AAT Bioquest ...
-
bioRxiv - Immunology 2020Quote: ... and 1-Ethyl-3-(3-dimethylaminopropyl) carbodiimide (Thermo Fisher Scientific). The activated beads were washed three times with 50 mM MES pH 5.0 and added to SARS-CoV-2 S protein which was diluted in 50 mM MES pH 5.0 ...
-
bioRxiv - Immunology 2022Quote: ... and 1-Ethyl-3-(3-dimethylaminopropyl) carbodiimide (Thermo Fisher Scientific) and incubated for 30 min on a rotator at room temperature ...
-
bioRxiv - Cell Biology 2022Quote: ... A 1 ml aliquot was treated with 2 μM tetramethylrhodamine methyl ester perchlorate (TMRE) (Molecular Probes, USA) and incubated at 37°C for 30 min ...
-
bioRxiv - Neuroscience 2020Quote: ... 1 mM EDTA plus PIC) with 20 mM thiol-reactive methyl-methane thiosulfonate (MMTS, Thermo Fisher Scientific) to block free cysteine residues ...
-
bioRxiv - Biochemistry 2023Quote: ... and 2) adding 25 μL of N-methyl-N-trimethylsilyltriAuoroacetamide (TMS) with 1% trimethylchlorosilane (Thermo Fisher Scientific) and incubated for 30 minutes at 60°C ...
-
bioRxiv - Developmental Biology 2022Quote: Total RNA was isolated from 6 pairs of P21 mouse testes (3 pairs of wild type and 3 pairs of Mov10-/-) using TRIzol reagents (Thermo Fisher Scientific). 1 μg of total RNA from each sample was used to generate RNA-seq libraries using TruSeq Stranded mRNA Library Preparation Kit Set A (Cat ...
-
bioRxiv - Bioengineering 2020Quote: ... methyl ester (TMRM) (0.1µM in hepatocyte medium, Thermo Fisher) to visualize active mitochondria ...
-
bioRxiv - Neuroscience 2022Quote: ... containing 80μL N-methyl-trimethylsilyl-trifluoroacetamide (MSTFA; ThermoFisher #TS48915) and gently vortexed followed by 30 min dry heat incubation at 37°C ...
-
bioRxiv - Bioengineering 2022Quote: ... in N-methyl-2-pyrrolidone (NMP) (>99%, Fisher Scientific), after freebasing when necessary.
-
bioRxiv - Bioengineering 2022Quote: ... mitochondrial membrane potential (tetramethylrhodamine methyl ester, TMRM; ThermoFisher Scientific) and mitochondrial superoxide (MitoSOX Red ...
-
bioRxiv - Genomics 2022Quote: ... Histone H3 Lysine 4 tri-methyl (ThermoFisher PA5-27029), Histone H3 Lysine 27 acetylation (Abcam ab4729) ...
-
bioRxiv - Neuroscience 2023Quote: ... containing 80μL N-methyl-trimethylsilyl-trifluoroacetamide (MSTFA; ThermoFisher #TS48915) and gently vortexed followed by 30 min dry heat incubation at 37°C ...
-
bioRxiv - Immunology 2022Quote: ... 12.5 mM methyl-α-d-mannopyranoside (Thermo Fisher Scientific), 100 U/ml penicillin ...
-
bioRxiv - Neuroscience 2023Quote: ... neurons were stained with tetramethylrhodamine methyl ester (TMRM) (Invitrogen) at a non-quenching concentration (20nM) ...
-
bioRxiv - Cancer Biology 2022Quote: ... methylparaben (Methyl 4-hydroxybenzoate, MP; Acros Organics, CAT: 126961000), and butylparaben (Butyl 4-hydroxybenzoate ...
-
bioRxiv - Genetics 2023Quote: ... and Tetramethylrhodamine methyl ester (TMRM, 0.1µM, Thermo Fisher I34361) for 30 minutes at 37°C and 5% CO2 ...
-
bioRxiv - Bioengineering 2024Quote: ... and tetramethylrhodamine methyl ester perchlorate (TMRE) (ThermoFisher, Waltham, MA) dyes ...
-
bioRxiv - Neuroscience 2022Quote: ... Cells were washed 3x with 1x PBS (5 minutes per wash) prior to 4’,6-diamidino-2-phenylindole (DAPI; 1:3000; Thermo Fisher) incubation for 5 minutes at room temperature to stain nuclei ...
-
bioRxiv - Genetics 2022Quote: ... ~1 × 105 hTSC were seeded onto 6 well plates coated with either 5–10 μg/mL collagen IV (10376931, Fisher Scientific) or 0.5 μg/mL iMatrix 511 (NP892-011 ...
-
bioRxiv - Biophysics 2023Quote: ... 400 μg of calmodulin and myosin-5 expression vectors (at a 1:6 ratio) were mixed with 15 ml FreeStyle 293 media (Thermo Fisher) and 1.2 ml of PEI (Polysciences ...
-
bioRxiv - Genetics 2023Quote: ... Cultures were passaged every 5-6 days as small clumps by dissociation with a buffer containing 1 mg per ml Collagenase IV (ThermoFisher Scientific), 0.025% Trypsin (ThermoFisher Scientific) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 0.7 mL Buffer 2 (1 M sorbitol, 50 mM MES, pH 6, 5 mM MgCl2) plus protease inhibitors (Thermo Scientific A32955) was added ...
-
bioRxiv - Developmental Biology 2022Quote: ... with a 6-FAM™ fluorescent tag at its 5’ end (Life Technologies). Three primers PCR amplification were performed using the Qiagen Multiplex PCR kit (206143 ...
-
bioRxiv - Developmental Biology 2022Quote: ... 5-(and-6)-chloromethyl-2′,7′ dicholorodihydrofluorescein diacetate (CM-H2DCFDA; Molecular Probes C6827), was used to visualize ROS accumulation (excitation ...
-
bioRxiv - Immunology 2022Quote: ... or 2.5μM of 5-(and-6)-Carboxy-2’,7’-Dichlorofluorescein Diacetate (DCFDA) (Invitrogen) was then added and incubated with the cells 20 minutes at 37°C ...
-
bioRxiv - Immunology 2020Quote: ... Cells were grown for 5–6 days in IMDM (Thermo Fisher Scientific, 12440053) supplemented with 1% non-essential amino acids (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2023Quote: ... or 5- (and -6)-chloromethyl- 2′,7′-dichlorofluorescein diacetate (CM-H2DCFDA, ThermoFisher, C6827), or hydroxyphenyl fluorescein (HPF ...
-
bioRxiv - Immunology 2024Quote: ... 5 µg of anti-CD8α APC-efluo780 (clone 53-6-7, eBioscience/Thermofisher) was injected intravenously (i.v. ...
-
bioRxiv - Developmental Biology 2020Quote: ... ToPro-3 (1:1000, Invitrogen). Secondary antibodies used in this study were purchased from Invitrogen and include ...
-
bioRxiv - Cell Biology 2019Quote: ... BODIPY-493/503 Methyl Bromide (used at 1/1000 from 1 mg/ml ethanol stock) and CellTracker green (C2925) from Thermo Fisher Scientific ...
-
bioRxiv - Evolutionary Biology 2022Quote: The purified RNA was used to amplify cDNA from the gUTRGFP template with the 5’ Cy-5 labelled pWP252fluor primer (5’ ATAACGGACTAGCCTTA 3’) using the standard Superscript III First-Strand Synthesis System (Thermo Fisher) with 3 µg of total RNA and elongating at 52.5°C for 60 min ...
-
bioRxiv - Genetics 2020Quote: ... using the primer pair IL613 (5’-ACAAACACAATCCCAAGTTC-3’) and IL792 (5’-CCTTTACTACGTTGGCG-3’) (21) and the 2X Phusion™ Flash High-Fidelity PCR Master Mix (ThermoFisher Scientific™, Waltham MA, USA) containing Phusion Flash II DNA polymerase which has proof-reading activity (36) ...
-
bioRxiv - Cell Biology 2021Quote: ... washed 3 times and incubated with 4’,6-Diamidino-2-phenylindole (DAPI; 2mg/ml) (Invitrogen) in PBS for 5 minutes ...
-
bioRxiv - Cell Biology 2020Quote: ... After washing and nuclear counterstaining with 4’,6-diamidino-2-phenylindole (DAPI, ThermoFisher, 3 µM), sections were mounted on microscopic slides using Aqua Poly/Mount (Polysciences) ...