Labshake search
Citations for Thermo Fisher :
551 - 600 of 10000+ citations for 6 Methyl benzo 1 3 dioxole 5 carbaldehyde since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2022Quote: ... Bisulfite-PCR was conducted using primer sets (Integrated DNA Technologies; Table 1) designed against specific genomic regions with Methyl Primer Express v1.0 software (Thermofisher Scientific). PCR amplicons were cleaned with AmpureXP beads (#A63882 ...
-
bioRxiv - Systems Biology 2021Quote: ... A total of 90 μL of N-methyl-N-(trimethylsilyl) trifluoroacetamide (MSTFA) + 1% trimethylchlorosilane (TMCS) (Thermo Scientific, Lafayette, CO, U.S.A.) was then added to the samples and shaken at 1400 rpm for 30 min at 37 °C ...
-
bioRxiv - Developmental Biology 2023Quote: ... Cells were cultured for 24 hours in culture medium supplemented with 0.5% (w/v) methyl cellulose and B-27 (1/50, Life technologies).
-
bioRxiv - Immunology 2021Quote: ... on the QuantStudio 5 or QuantStudio 3 Real-Time PCR System (ThermoFisher Scientific). Relative transcript levels were normalized to TATA-binding protein (Tbp ...
-
bioRxiv - Neuroscience 2020Quote: ... and 0.175 g/ml 5-bromo-4-chloro-3-indolyl-phosphate (BCIP) (Invitrogen). Alkaline phosphatase staining reaction was proceeded o/n at RT ...
-
bioRxiv - Genomics 2020Quote: ... or a positive control probe 5’-5Alexa488N/(ATA)8TUU (ATA)7-3’ (Invitrogen). Reactions were incubated in a water bath at 37°C for 2 hrs ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 5 mM succinimidyl 3-(2-pyridyldithio)propionate (SPDP) (Thermo Fisher Scientific, USA) in PBS (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2020Quote: Non-targeting control (CTRL) (Dharmacon) 5’-UGGUUUACAUGUCGACUAA-3’ KIF18A (Silencer Select s37882 – Ambion)8 5’-UCUCGAUUCUGGAACAAGCAG-3’ RAD51 (Silencer Select s11735 – Ambion ...
-
bioRxiv - Bioengineering 2021Quote: ... or siRNA targeting CTNNB1 (siCTNNB1, targeting sequence 5′- CCACAGCUCCUUCUCUGAGUGGUAA -3’, ThermoFisher, Waltham, MA) were resuspended in 50 μL of Opti-MEM and incubated at room temperature for 30 min ...
-
bioRxiv - Immunology 2022Quote: ... and 5 mM succinimidyl 3-(2-pyridyldithio)propionate (SPDP, Thermo Fisher Scientific, USA) in PBS (Thermo Fisher Scientific ...
-
bioRxiv - Developmental Biology 2019Quote: ... with 3 M Na-Acetate and linear polyacrylamide (5 mg/mL, Ambion®) overnight at −80°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... 3′-end fluorescent labeling of the RNAs with fluorescein-5-thiosemicarbazide (ThermoFisher Scientific) was done as previously reported (Grozdanov and Stocco ...
-
bioRxiv - Microbiology 2020Quote: ... 3 to 5 colonies were transferred in Mueller-Hinton broth (Thermo Scientific Oxoid) and adjusted to an optical density at 600nm (OD ...
-
bioRxiv - Immunology 2020Quote: Pieces of 3 mm3 tumors were submerged in 5 vol of RNAlater (Invitrogen) (n = 5 samples/group) ...
-
bioRxiv - Developmental Biology 2020Quote: 3 × 106 ESC cells were distributed to 5 12-well dishes (Thermo Scientific) with 5 × 105 mESC cells per well ...
-
bioRxiv - Immunology 2022Quote: ... 5 μl RNA (2ng/μg) and 3 μl of 5x Primer stock (ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... Amplifications were run on a QuantStudio 3 or 5 thermal cycler (Thermo Fisher) and results were analyzed using the instrument software ...
-
bioRxiv - Cell Biology 2023Quote: ... vector encoding a sgRNA targeting PAC (5′-TGTCGAGCCCGACGCGCGTG-3′) using Lipofectamine 2000 (Invitrogen). GFP positive cells were isolated by FACS two days after infection ...
-
bioRxiv - Developmental Biology 2023Quote: ... cells were passaged every 3-5 days using Accutase or ReleSR (ThermoFisher Scientific).
-
bioRxiv - Molecular Biology 2023Quote: ... 3 × 10-4 M MTG and 5% Protein-Free Hybridoma Media II (Gibco).
-
bioRxiv - Cancer Biology 2023Quote: 5’ and 3’ RACE was performed using the GeneRacer kit (Thermo Fisher Scientific), following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2020Quote: ... Asaia1 (5’-AGC ACC AGT TTC CCG ATG TTA T-3’) and Asaia2 (5’-GAA ATA CCC ATC TCT GGA TA-3’) labeled with Alexa Fluor® 555 (Invitrogen). Tissues were visualized using Nikon ECLIPSE IVi microscope connected to a Nikon DIGITAL SIGHT DS-U3 digital camera.
-
bioRxiv - Neuroscience 2019Quote: ... sections were washed in PBS (5 × 3 minutes) and then incubated 3 hours in a cocktail of secondary antibodies conjugated to Alexa Flour dyes (Life Technologies) to tag the primary antibodies at a concentration of 1:500 ...
-
bioRxiv - Cancer Biology 2020Quote: ... and scrambled control mimics (sense 5’ - mCmArUmArUmUrGmCrGmCrGmUrAmUrAmGrUmCrGC - 3’; antisense5’ - /5Phos/rGrCrGrArCrUrArUrArCrGrCrGrCrArArUrArUmGmG rU - 3’; IDT) were reverse transfected at 2nM using Lipofectamine RNAiMax (Life Technologies) according to manufacturer guidelines.
-
bioRxiv - Physiology 2021Quote: ... RNA targeting exon 3 of Ctns (gRNA-ex3 5’-ATCTTTCCAGAATCAACCGTCGG-3’) was produced using the Precision gRNA Synthesis Kit (Thermo Scientific). Online tools RGEN (http://www.rgenome.net/cas-designer/ ...
-
bioRxiv - Immunology 2023Quote: ... and 500 nM each of the forward primer and reverse primer (Table 3) with the following cycling conditions on either QuantStudio 3 or 5 Real-Time PCR systems (Applied Biosystems): 95°C for 2 min ...
-
bioRxiv - Neuroscience 2020Quote: ... a selected cell terminal was puffed for 5 s with a solution containing 3-5 μM FM1-43 (Molecular Probes) and (in mM) ...
-
bioRxiv - Microbiology 2020Quote: The Q577R gp41 change was introduced into pSHIV-AD8-EO via site-directed mutagenesis using 5’p-TCAAGCAGCTCCGGGCAAGAGTCC-3’ (forward) and 5’p-TGCCCCAGACTGTGAGTTGCAACA (reverse) with Platinum SuperFi PCR mastermix (ThermoFisher) as described in the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2022Quote: ... Sections were then washed 3 x 5 min in PBS and incubated for 5 min in DAPI (Invitrogen, cat# D1306) 1:1000 in PBS ...
-
bioRxiv - Cancer Biology 2022Quote: ... minced skin was incubated at 37°C for 3 – 5 hours in 5 ml of DMEM high glucose (#41965-039; Gibco) supplemented with 10 mg ml-1 collagenase (#C9891 ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... 1.5 µg of total RNA of each sex were subjected to 5’ and 3’ RACE with a GeneRacer kit (Invitrogen) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2022Quote: ... To-Pro-3 (1:500, Invitrogen T3605). Secondary antibodies were obtained from Jackson ImmunoResearch or Invitrogen and used at 1:200.
-
bioRxiv - Biochemistry 2022Quote: ... 3) 1% Pluronic-127 (cat. # P6866, ThermoFisher) in BRB80 ...
-
bioRxiv - Systems Biology 2022Quote: ... diluted 1:3 with DPBS (Life Technologies) and 25μL added to the wells ...
-
bioRxiv - Bioengineering 2021Quote: ... + 1 × 10−3 M sodium pyruvate (Gibco) + 0.05 × 10−3 M 2-mercaptoethanol (Sigma)] supplemented with soluble anti-mouse CD28 (5 µg/ml ...
-
bioRxiv - Neuroscience 2020Quote: ... and Toto-3 (1:1000; Thermo Fisher) as nuclear counterstain.
-
bioRxiv - Immunology 2022Quote: ... ICOS-SB436 (ISA-3, Invitrogen, 1:50), IgG-BV480 (goat polyclonal ...
-
bioRxiv - Developmental Biology 2023Quote: ... or TO-PRO-3 (1:50000, ThermoFisher) for 1 hour at room temperature or overnight at 4°C ...
-
bioRxiv - Cancer Biology 2023Quote: ... proteinase K (3 μg ml−1; ThermoFisher) digestion ...
-
bioRxiv - Immunology 2023Quote: ... claudin-3 (1:200; Thermo Fisher Scientific), claudin-15 (1:200 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1-3 L of Expi293F cells (ThermoFisher) were grown at 37°C to a cell density of 3.2×106 cells/mL in FreeStyle expression medium (ThermoFisher) ...
-
bioRxiv - Bioengineering 2024Quote: ... and TO-PRO-3 (1:5000, ThermoFisher). The combination of Nucred Dead 647 and TO-PRO-3 has previously been described by Dekkers et al24 ...
-
bioRxiv - Genetics 2023Quote: ... diluted 1:3 in 1X PBS (Gibco). Trypsin was inactivated by cell media.
-
bioRxiv - Cancer Biology 2024Quote: ... 3% H2O2 (Fisher Scientific 7722-84-1) was used ...
-
bioRxiv - Genetics 2021Quote: ... and subsequently counterstained with DAPI (1:30,000 of 5 mg/ml) for 3 minutes and mounted using Antifade reagent (ProLong Gold Antifade Reagent, Invitrogen, cat. number P36934). Images were taken and processed using an Airyscan980 SR confocal microscope (Zeiss).
-
Turanose induced WOX5 restores symbiosis in the Medicago truncatula cytokinin perception mutant cre1bioRxiv - Plant Biology 2020Quote: ... and immersed and incubated in the dark in staining solution 1 mM 5-bromo-4-chloro-3-indolyl-β-D-glucuronicacid (X-Gluc, Thermo Scientific), 50mM sodium phosphate buffer ...
-
bioRxiv - Molecular Biology 2019Quote: One microgram of peptides in a volume of 1-4 μL was loaded onto the Acclaim μ-Precolumn (0.5 mm х 3 mm, 5 μm particle size, Thermo Scientific) at a flow rate of 10 μL/min for 4 min in an isocratic mode of Mobile Phase C (2% MeCN ...
-
bioRxiv - Cell Biology 2020Quote: ... Flow settings were adjusted to allow individual cells to become encapsulated with single hydrogel beads presenting cell-specific barcoding oligonucleotide primers inside 3-5 nL encapsulation mixture droplets that contain 20 U μL−1 reverse transcriptase (SuperScript III, Thermo Fisher Scientific), First-Strand Buffer (Thermo Fisher Scientific) ...
-
bioRxiv - Biochemistry 2021Quote: ... One microgram of peptides in a volume of 1-4 µL was loaded onto the Acclaim µ-Precolumn (0.5 mm х 3 mm, 5 µm particle size, Thermo Scientific) at a flow rate of 10 µL/min for 4 min in an isocratic mode of Mobile Phase C (2% acetonitrile (Sigma-Aldrich) ...
-
bioRxiv - Microbiology 2020Quote: ... and a newly designed 5’ FAM-labelled and 3’-minor groove binder (MGB)-modified probe SVIP-MP_P2-MGB ((Table 1; ThermoFisher Scientific, Eurofins Genomics). The primers encompass a 182 nucleotides-long amplicon ...