Labshake search
Citations for Thermo Fisher :
1 - 50 of 10000+ citations for 6 Methyl benzo 1 3 dioxole 5 carbaldehyde since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2022Quote: ... Mitochondria membrane polarization was measured by loading cells with 2 µM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, 15003) at 37°C for 15 min ...
-
bioRxiv - Molecular Biology 2022Quote: ... cells were incubated in 2 μM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, cat no: T3168) at 37°C for 15 min ...
-
bioRxiv - Microbiology 2020Quote: ... and 1:1 3-methyl-1-butanol (Thermo Fisher Scientific) in mineral oil were used as cues ...
-
bioRxiv - Zoology 2020Quote: ... 2’-(4-ethoxyphenyl)-5-(4-methyl-1-piperazinyl)-23491-52-3 (Hoechst 33342, trihydrochloride, trihydrate, Life Technologies, H3570) in water for 20 min ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies) ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies), and parasite burden was calculated based on the standard curve of known parasite contents(24).
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μM of oligonucleotide labeled with 6-carboxyfluorescein (6-FAM) at the 5’ end (5’– AACGACGGCCAGTGAATCCGTAATCATGGT–3’, Invitrogen), 50 μM each dNTP ...
-
bioRxiv - Cell Biology 2022Quote: ... C12 (4,4-Difluoro-5-Methyl-4-Bora-3a,4a-Diaza-s-Indacene-3-Dodecanoic Acid) (Invitrogen) at 2 mg/ml in PBS for 10 min or with Laurdan (see above ...
-
bioRxiv - Microbiology 2023Quote: ... The infection was incubated for 2-3 hours at 37°C and then the viral inoculum was removed and replaced with a pH 7.2 methyl cellulose overlay medium (1% methyl cellulose [Sigma-Aldrich, MA]/5% FBS [Gibco, MA]/1X penicillin-streptomycin [Gibco ...
-
bioRxiv - Microbiology 2023Quote: ... The infection was incubated for 2-3 hours at 37°C and then the viral inoculum was removed and replaced with a pH 7.2 methyl cellulose overlay medium (1% methyl cellulose [Sigma-Aldrich, MA]/5% FBS [Gibco, MA]/1X penicillin-streptomycin [Gibco, MA]/44 mM sodium bicarbonate [Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2020Quote: ... were purchased from Click Chemistry Tools and Tris [(1-benzyl-1H-1, 2, 3-triazol-4-yl)methyl] amine from Fisher Scientific.
-
bioRxiv - Neuroscience 2022Quote: ... 5 mM methyl-β-cyclodextrin (Acros Organics, NJ) (mβCD ...
-
bioRxiv - Molecular Biology 2019Quote: ... miR-125b+A or control RNA 3’O-methyl-modified mimic using 5 μl Lipofectamine 2000 (Life Technologies) in a 500 μl reaction mixture according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... n = 3) or oligopyridylamides (5 µM ADH-1 or ADH-6, n = 3) using a combination of both TriZol (Thermo Fisher Scientific) and RNAeasy Mini Kit (Qiagen ...
-
bioRxiv - Cell Biology 2023Quote: ... siARP2/3 (5’- GGAUUCCAUUGUGCAUCAAtt-3’, 5’-GGGAUGAUGAGACCAUGUAtt-3’, 5’- AAAUCCUAAUGGAGACAAAtt-3’, Ambion)
-
bioRxiv - Microbiology 2020Quote: ... 6-carboxyfluorescein (FAM)-5= CCG TCA ATC AAG GAG CGC CTC 3=-6 carboxytetramethylrhodamine (TAMRA) (Life Technologies).Viral RNA was detected using the CFX96 detection system (Bio-Rad Laboratories ...
-
bioRxiv - Microbiology 2021Quote: ... 6-carboxyfluorescein (FAM)-5’ CCG TCA ATC AAG GAG CGC CTC 3’-6 carboxytetramethylrhodamine (TAMRA) (Life Technologies).Viral RNA was detected using the CFX96 detection system (Bio-Rad Laboratories ...
-
bioRxiv - Cell Biology 2020Quote: ... Lipin-1 siRNA 5’-GAAUGGAAUGCCAGCUGAA-3’ and 3’-UUCAGCUGGCAUUCCAUUC-5’ (Invitrogen; HSS118307 (Sigma); optineurin siRNA (Invitrogen 4392420) ...
-
bioRxiv - Neuroscience 2020Quote: ... Cells were then passaged 1:3-1:6 every 2-3 days using Accutase (Gibco).
-
bioRxiv - Bioengineering 2019Quote: ... C12 (4,4-Difluoro-5-Methyl-4-Bora-3a,4a-Diaza-s-Indacene-3-Dodecanoic Acid;D3823, Thermo Fisher Scientific), was added to the culture medium for a duration of 60 min and pumped through the media systems at 80 µl/h via positive pressure provided by a syringe pump ...
-
bioRxiv - Microbiology 2021Quote: ... The freeze-dried material was dissolved in 300 μl of 6:1 (v/v) of methyl sulphoxide D6 (99.9% atom D + 1% tetramethylsilane, ACROS Organics):D2O (100% atom D ...
-
bioRxiv - Immunology 2021Quote: ... Mice were genotyped by PCR using forward primers 5’-ctgagcagagacccactgaaag-3’ and reverse primers 5’- ggatctggcttctgagtttgtgta-3’ and amplicons were ran in 6% TBE gels (Life Technologies, Carlsbad, CA).
-
bioRxiv - Microbiology 2019Quote: ... 2 mM 3-methyl-2-oxobutanoic acid (Fisher Scientific, Hampton, NH) and 1 mM acetyl-CoA (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2019Quote: RNF168 si #1: 5’- GGCGAAGAGCGAUGGAGGATT-3’ (Ambion)
-
bioRxiv - Genomics 2023Quote: The PPMI iPSC lines were thawed and grown on matrigel (Corning)-coated plates with Essential 8 Flex (E8, Batches 1, 2 and 3) or Essential 6 (E6, Batches 4 and 5) media (both Gibco) for about one month (5 passages) ...
-
bioRxiv - Bioengineering 2019Quote: ... The fixed cells were stained with 1 µM 2’-[4-ethoxyphenyl]-5-[4-methyl-1-piperazinyl]-2,5’-bi-1H-benzimidazole trihydrochloride trihydrate (Hoechst 33342, Invitrogen) for 5 minutes ...
-
bioRxiv - Microbiology 2020Quote: ... PobA activity was inhibited with methyl 4-hydroxy-3-iodobenzoate (Fisher Scientific) at a saturating concentration (0.48 mM) ...
-
bioRxiv - Cell Biology 2023Quote: ... 2- & 3-methyl pentane and n-hexane (Thermo Scientific, Waltham, MA, USA). Reported compounds detected by the GC-MS were confirmed by matching retention times and mass–charge (m/z ...
-
bioRxiv - Developmental Biology 2023Quote: ... Pax9 was cloned from 24 hpf cDNA using the primers pax9F 5’-TCTAGAATGGAGCCAGCCTTT-3’ and pax9R 5’-ATGGATCCTCATAGAGCTGAAGCCACCAG-3’ (Supplementary Table 6) and cloned by TOPO-TA to the pCRII vector (Invitrogen) to create pCRII pax9 ...
-
bioRxiv - Microbiology 2020Quote: ... Fungal hyphae were stained with 0.5 mM 4.4-difluoro-5-methyl-4-bora-3a,4a-diaza-s-indacene-3-dodecanoic acid (C1-BODIPY 500/510 C12, Thermo Fisher Scientific) or 4.4-difluoro-5,7-dimethyl-4-bora-3a,4a-diaza-s-indacene-3-hexadecanoic acid (BODIPY FL C16 ...
-
bioRxiv - Biochemistry 2023Quote: ... 0.1 μM 6-JOE-conjugated reverse primer (5’-6-JOE-GATGATCTCCACCTTGCCGT-3’) was extended with 1 pmol of RNA as template using Superscript III (Thermo Fisher) as reverse transcriptase ...
-
bioRxiv - Immunology 2021Quote: ... was added as the secondary antibody at a 1:2000 dilution for 1 h at 37C, followed by adding TMB (3, 3, 5, 5’-tetramethylbenzidine) peroxidase substrate (Thermo Scientific) for about 15 min ...
-
bioRxiv - Neuroscience 2019Quote: ... Neurons were transfected with the CofActor optogenetic system (6 µg plasmid/plate) on day in vitro 3-5 (DIV3-5) using Lipofectamine 2000 (Invitrogen). 48 hours post transfection ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were also stained for 30 minutes simultaneously with 1 μM 2′-[4-ethoxyphenyl]-5-[4-methyl-1-piperazinyl]−2,5′-bi-1H-benzimidazoletrihydrochloride trihydrate (Hoechst 33342, Fisher Scientific) for nuclear visualization and cell localization ...
-
bioRxiv - Cancer Biology 2019Quote: ... All TaqMan probes were 5′-6-carboxyfluorescein (FAM) and 3′-6-carboxy-N,N,N′,N′-tetramethylrhodamine (TAMRA) labeled (Applied Biosystems, US) except TATA-binding protein (TBP ...
-
bioRxiv - Cell Biology 2020Quote: ... 5 micromols sodium sulfo-NHS and 5 micromols 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC) (Thermo Fisher #22980) in 10 μL of DMSO ...
-
bioRxiv - Cell Biology 2020Quote: ... EndoB1 siRNA 5’-UGUUUAUACGACUUGGAGCUU-3’ and 3’-AAGCUCCAAGUCGUAUAAACA-5’ (Invitrogen), control siRNA (Ambion) ...
-
bioRxiv - Cell Biology 2023Quote: ... siPALS1 (5’-UUCCUUAUGAUGAACUGGCtt-3’) and siPATJ (5’-CCAGAUACUCACACUUCAGtt-3’, Ambion), siARP2/3 (5’- GGAUUCCAUUGUGCAUCAAtt-3’ ...
-
bioRxiv - Cell Biology 2020Quote: ... or a 1:1 mixture of two siRNA to CHMP2A (5’-CAGGCCGAGAUCAUGGACAUG-3’ and 5’-GAAGAUGAAGAGGAGAGUGAC-3’) using Lipofectamine 2000 (Thermo Fisher Scientific) according to the manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2022Quote: 3×10^6 S2 cells (Invitrogen)/well were plated on a 6-well plate in Complete Schneider’s media supplemented with 10% FBS and pen/strep (CS10PS) ...
-
bioRxiv - Microbiology 2023Quote: ... Tris(hydroxymethyl)methyl-3-amino propane sulfonic acid (TAPS) was purchased from Acros Organics. Mal-PEG ...
-
bioRxiv - Microbiology 2021Quote: ... Reverse 5’-CGA AGG TGT GAC TTC CATG-3’) on a QuantStudio 6 Flex thermocycler (Applied Biosystems). A standard curve was established in parallel using purified SARS-CoV-2 viral RNA.
-
bioRxiv - Microbiology 2020Quote: ... 5-(and-6)-carboxyfluorescein (FAM) and 5-(and-6)-carboxytetramethylrhodamine (TAMRA) were obtained from Invitrogen™ ...
-
bioRxiv - Cancer Biology 2021Quote: ... carrying the mutation R273C was first amplified by PCR using the primers hp53-1 (5’-CACCATGGAGGAGCCGCAGTCAGATCC-3’) and hp53-8 (5’-GGATCCTCAGTCTGAGTCAGGCCCTTCTGTCTTG-3’) and cloned into the pENTR/D-TOPO vector (ThermoFisher) generating the entry vector pENTR p53(R273C ...
-
bioRxiv - Immunology 2022Quote: ... with siRNAs against SAMHD1 (sense RNA 5’-GCAGAUAAGUGAACGAGAUTT-3’, antisense RNA 5’-AUCUCGUUCACUUAUCUGCAG-3’) or the negative control #1 siRNA (Ambion). Three days after transfection with either siRNA or shRNA plasmids ...
-
bioRxiv - Neuroscience 2022Quote: ... the sgRNA sequence targeting exon 1 of Faah (5’-CTGCAGGCTAGGCAAACC-3’) and a control sgRNA sequence (5’-CTGCAGGCTAGGCAAACCTTT-3’ were synthesized (Invitrogen) and cloned into the shuttle plasmid for adeno-associated viral (pAAV-FLEX-SaCas9-U6-sgRNA;Addgene #124844 ...
-
bioRxiv - Microbiology 2023Quote: ... or alkaline phosphatase was added at a 1:2,000 dilutions for 1 h at 37ºC followed by adding TMB (3, 3, 5, 5′-tetramethylbenzidine) peroxidase substrate (Thermo Scientific) or p-nitrophenyl phosphate (Sigma-Aldrich) ...
-
bioRxiv - Cell Biology 2021Quote: ... 5 L-malic acid and 20 μM tetramethylrhodamine methyl ester (TMRM, Thermo Fisher) for 10 minutes ...
-
bioRxiv - Biochemistry 2023Quote: ... 5’-UUCUCCGAACGUGUCACGUTT-3’ and 5’-ACGUGACACGUUCGGAGAATT-3’ using Lipofectamine RNAiMIX reagent (Invitrogen) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2020Quote: ... and 1 µM TMRM (tetramethylrhodamine, methyl ester, perchlorate; Invitrogen), and incubated at 37°C for 15 min ...