Labshake search
Citations for Thermo Fisher :
201 - 250 of 10000+ citations for 6 Fluoro 2 hydrazino 3 methylquinoline hydrochloride since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... Laurdan (6-Dodecanoyl-2 Dimethylaminonaphthalene Thermo Fisher Scientific, MA) was dissolved in DMF (Sigma Aldrich ...
-
bioRxiv - Cell Biology 2024Quote: ... 4’,6-diamiino-2-phenylindole (DAPI; Invitrogen, Cat# D21490) diluted 1:1000 in PBS was applied for 15 minutes at room temperature with plates subsequently washed ...
-
bioRxiv - Neuroscience 2024Quote: ... 4’,6-diamidino-2-phenylindole (DAPI; Invitrogen Corp., USA) was used for counterstaining ...
-
bioRxiv - Microbiology 2024Quote: ... and 6 µL 2-mercaptoethanol (Fisher Chemical, Fisher Scientific) were added to a Qiagen powerbead tube ...
-
bioRxiv - Biophysics 2021Quote: ... at a ratio of 1:1.5:1.75:2 (FAM155A-3×FLAG:NALCN-1077-3×HA-GFP:UNC79-3×FLAG:UNC80-3×FLAG) using Lipofectamine 3000 (Thermo Fisher Scientific) and incubated for 40-48 hours ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies), and parasite burden was calculated based on the standard curve of known parasite contents(24).
-
bioRxiv - Microbiology 2019Quote: ... 2 mM 3-methyl-2-oxobutanoic acid (Fisher Scientific, Hampton, NH) and 1 mM acetyl-CoA (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2022Quote: ... 2 x10^6 in 6 cm dishes or 4 x10^6 in 10 cm dishes (Nunc Edge plates, Thermo Fisher Scientific) in conditioned NB or NB-Plus ...
-
bioRxiv - Neuroscience 2022Quote: ... 2 x10^6 in 6 cm dishes or 4 x10^6 in 10 cm dishes (Nunc Edge plates, Thermo Fisher Scientific) in conditioned NB or NB-Plus ...
-
bioRxiv - Immunology 2021Quote: ... 2-3 ml RBC Lysing Buffer (Invitrogen) was added to the pellet containing splenocytes and incubated at room temperature for 5-7 min ...
-
bioRxiv - Microbiology 2020Quote: ... and IFNλ−2/3 (Thermo Scientific Mm04204156_gH) and results were normalized to GAPDH (Mm.PT.39a.1 ...
-
bioRxiv - Immunology 2022Quote: ... Supernatants were mixed with × SDS sample buffer supplemented with Tris(2-carboxyethyl)phosphine hydrochloride (TCEP, Thermo Fisher Scientific) and boiled at 100°C for 5 minutes ...
-
bioRxiv - Neuroscience 2023Quote: Cocaine hydrochloride (graciously provided by NIDA) was dissolved at 2 mg/ml in 0.9% sterile saline (Thermo Fisher) and filter-sterilized.
-
bioRxiv - Immunology 2024Quote: ... Dried polar metabolites were dissolved in 15 μL of 2% methoxyamine hydrochloride in pyridine (Thermo Fisher Scientific, 25104) at 55°C ...
-
bioRxiv - Immunology 2020Quote: ... Fluorescent dyes including 4′,6-diamidino-2-phenylindole (DAPI, Invitrogen, D21490, 2 μg/mL), wheat germ agglutinin (WGA ...
-
Immunoresolvents Support Skeletal Myofiber Regeneration via Actions on Myeloid and Muscle Stem CellsbioRxiv - Immunology 2020Quote: ... Fluorescent dyes including 4′,6-diamidino-2-phenylindole (DAPI, Invitrogen, D21490, 2 μg/mL), wheat germ agglutinin (WGA ...
-
bioRxiv - Immunology 2023Quote: ... post-dose 3 and 6-months post-dose 3 using mouse anti-human IgG1 biotin (Thermo Fisher Scientific) and mouse anti-human IgG4 biotin (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2021Quote: ... using QuantStudio 6 or 3 Flex Real-Time PCR System (Applied Biosystems). SARS-CoV-2 standards with known copy numbers were used to construct a standard curve and calculate copy numbers/mL or copy numbers/g.
-
bioRxiv - Cancer Biology 2021Quote: ... 10 ng/ml IL-6 and 10 ng/ml IL-3 (Gibco). Inpp4b+/+ and Inpp4b-/- LSK were each retrovirally transduced with pMSCV-MLL-AF9-IRES-mVenus ...
-
bioRxiv - Microbiology 2023Quote: ... using QuantStudio 6 or 3 Flex Real-Time PCR System (Applied Biosystems). SARS-CoV-2 standards with known copy numbers were used to construct a standard curve and calculate copy numbers/mL or copy numbers/g ...
-
bioRxiv - Neuroscience 2021Quote: ... either filled with 5 µl of 10% Fluoro-Ruby (Invitrogen, Carlsbad, CA, USA) or 5 µl of 2% Fast-Blue (Polysciences ...
-
bioRxiv - Molecular Biology 2023Quote: ... Biotin was immunostained using Alexa Fluoro 647-conjugated streptavidin (#S21374; Thermo Fisher Scientific).
-
bioRxiv - Neuroscience 2022Quote: ... CAT-1 (encoded by SLC7A1) and CAT-3 (encoded by SLC7A3) had 4 substrates including L-Lysine hydrochloride (Fisher Scientific #BP386), L-Histidine (Sigma-Aldrich #H6034) ...
-
bioRxiv - Developmental Biology 2020Quote: ... (N-((6-(2,4-DNP)Amino)Hexanoyl)-1-(BODIPY® F C5)-2-Hexyl-Sn-Glycero-3-Phosphoethanolamine) was purchased from Molecular Probes (Melbourne, VIC, Australia). The TiO2 was collected from a disassembled column ...
-
bioRxiv - Neuroscience 2024Quote: ... Peptides were loaded onto a C18 pre-column (3 μm, 75 mm i.d. × 2 cm, 100 Å, Thermo Fisher Scientific Cat# 16-494-6) then separated on a reverse-phase nano-spray column (2 μm ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... #2: 5’-gatcccGATTACTCGGCCATGATCAAAgcttcctgtcacTTTGATCATGGCCGAGTAATCttt ttta-3’ and 5’-agcttaaaaaaGATTACTCGGCCATGATCAAAgtgacaggaagcTTTGATCATGGCCGAGTAATgg-3’ were purchased from Invitrogen. The DNA oligo pairs were annealed and inserted into pEntryCla12-chickU6 shuttle vector using BamHI/HindIII site.
-
bioRxiv - Biochemistry 2019Quote: ... The samples were reduced with 2 µL of 200 mmol/L Tris(2-carboxyethyl)phosphine hydrochloride (TCEP, Thermo Scientific; final concentration of 14.8 mmol/L) and incubated at room temperature for 30 min ...
-
bioRxiv - Neuroscience 2023Quote: PSEM308 hydrochloride (Fisher Scientific, 64-252-5) was dissolved in DMSO to obtain a stock solution of 5 mg/ml ...
-
bioRxiv - Biochemistry 2023Quote: ... 21μM thiamine hydrochloride (Fisher Scientific, Waltham, MA), 0.5 % glycerol (Fisher Scientific ...
-
bioRxiv - Cell Biology 2020Quote: ... 4’,6’-diamidino-2-phenylindole (DAPI) (Thermo Fisher Scientific, D1306) was utilized to detect the nuclei ...
-
bioRxiv - Microbiology 2021Quote: ... and 4′,6-diamidino-2-phenylindole (DAPI) (Thermo Fisher Scientific).
-
bioRxiv - Genomics 2020Quote: ... 4’,6-diamidino-2-phenylindole (DAPI) (1:1000) (Life Technologies) was added to visualize cell nuclei ...
-
bioRxiv - Neuroscience 2020Quote: ... DAPI (4’,6-diamidino-2-phenylindole dihydrochloride, ThermoFisher Scientific, D1306) was applied to nuclei samples at a concentration of 0.1µg/ml ...
-
bioRxiv - Bioengineering 2020Quote: ... incubated with 4′,6-diamidino-2-phenylindole (DAPI, Thermo Fisher), rinsed with TBS ...
-
bioRxiv - Biochemistry 2021Quote: ... followed by 6 column volumes of elution buffer (2× GIBCO 14200-075 PBS ...
-
bioRxiv - Biophysics 2020Quote: ... and 4’,6-diamidino-2-phenylindole (DAPI, Thermo Fisher Scientific) were employed for actin cytoskeleton and nucleus staining ...
-
DNA uptake by cell wall-deficient bacteria reveals a putative ancient macromolecule uptake mechanismbioRxiv - Microbiology 2022Quote: ... 10 mM Laurdan (6-Dodecanoyl-2-Dimethylaminonapthalene) stock solution (Invitrogen) was prepared in 100% dimethylformamide (DMF ...
-
bioRxiv - Cancer Biology 2020Quote: ... SSC and DAPI (4’,6-diamino-2-phenylindole) (Fisher Scientific) staining profiles ...
-
bioRxiv - Physiology 2021Quote: ... 6-diamidino-2-phenylindole (DAPI) was used (Invitrogen; 1:5000).
-
bioRxiv - Physiology 2022Quote: ... 6-diamidino-2-phenylindole (DAPI) (1:1000, Thermo Fisher Scientific). The stains were analyzed using a microscope (Zeiss ...
-
bioRxiv - Neuroscience 2022Quote: ... 6-diamidino-2-phenylindole (DAPI) (1:1000, Thermo Fisher Scientific). The stains were analyzed using a microscope (Zeiss ...
-
bioRxiv - Bioengineering 2019Quote: ... 4’,6-diamidino-2-phenylindole (DAPI, NucBlue Fixed, Life Technologies) for cell count and nuclear aspect ratio ...
-
bioRxiv - Neuroscience 2019Quote: ... counterstained with 4’,6-diamidino-2-phenylindole dihydrochloride (DAPI;ThermoFisher) and mounted with Vectashield H1400 Hardset Mounting Medium (Vector Labs) ...
-
bioRxiv - Molecular Biology 2020Quote: ... pH 6 using a 2 kDa MWCO dialysis unit (ThermoFisher). Heats of binding were measured using a MicroCal iTC200 calorimeter (GE Healthcare ...
-
bioRxiv - Cell Biology 2019Quote: ... DAPI (4’,6-diamino-2-phenylindole, Life Technologies, Ref#D3571) and Calcein AM staining profiles and Calcein AM (Life Technologies ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... containing 4′,6-diamidino-2-phenylindole (DAPI; Invitrogen, Cat # P36935), and analyzed by LSM510 Meta Laser or Leica TCS SPE confocal microscopes (× 63 glycerol immersion objectives ...
-
bioRxiv - Cell Biology 2021Quote: ... 6 - diamidino-2-phenylindole (DAPI, 5 µg/ml, Life Technologies).
-
bioRxiv - Cell Biology 2021Quote: ... and 4′,6-diamidino-2-phenylendole (DAPI; 1:5000, Invitrogen) or Hoechst (1:10,000 ...
-
bioRxiv - Neuroscience 2022Quote: ... 6-diamidino-2-phenylindole (DAPI) (1:1000, Thermo Fisher Scientific). The staining was visualized using a microscope (Zeiss ...
-
bioRxiv - Cancer Biology 2022Quote: ... DAPI (4′,6-Diamidino-2-Phenylindole; Thermo Fisher Scientific, D1306),