Labshake search
Citations for Thermo Fisher :
1 - 50 of 10000+ citations for 6 Fluoro 2 hydrazino 3 methylquinoline hydrochloride since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... 1.9g of ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC) (ThermoFisher #22980) and 1.2g of N-hydroxysuccinimide (NHS ...
-
bioRxiv - Physiology 2022Quote: ... Mitochondria membrane polarization was measured by loading cells with 2 µM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, 15003) at 37°C for 15 min ...
-
bioRxiv - Neuroscience 2023Quote: ... DAPI (4′,6-diamidino-2-phenylindole, 3 uM final) (Invitrogen, D1306) was used to stain the DNA content of cells so that doublets and debris could be removed by sorting on the DAPI height vs DAPI area ...
-
bioRxiv - Neuroscience 2020Quote: ... Cells were then passaged 1:3-1:6 every 2-3 days using Accutase (Gibco).
-
bioRxiv - Bioengineering 2023Quote: ... and EDC (1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride) were purchased from Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2022Quote: ... cells were incubated in 2 μM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, cat no: T3168) at 37°C for 15 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μM of oligonucleotide labeled with 6-carboxyfluorescein (6-FAM) at the 5’ end (5’– AACGACGGCCAGTGAATCCGTAATCATGGT–3’, Invitrogen), 50 μM each dNTP ...
-
bioRxiv - Biochemistry 2020Quote: Beads were first activated with 1-ethyl-3-[3-dimethylaminopropyl]carbodiimide hydrochloride (Thermo Fisher Scientific) in the presence of N-hydroxysuccinimide (Thermo Fisher Scientific) ...
-
bioRxiv - Neuroscience 2023Quote: ... 1-ethyl-3-[3-dimethylaminopropyl] carbodiimide hydrochloride (EDC) was obtained from Life Technologies (Carlsbad, CA) and N-hydroxysulfosuccinimide (NHSS ...
-
bioRxiv - Cell Biology 2023Quote: ... then counterstained with Fluoro-gel II containing DAPI (Fluoro-Gel, Fisher Scientific Intl INC, PA). Asc-citrine photographs were taken using ZEISS microscopy (Carl Zeiss Industrial Metrology ...
-
bioRxiv - Cell Biology 2021Quote: ... N-hydroxysulfosuccinimide (sulfo-NHS) and 1-ethyl-3-[3-dimethylaminopropyl]carbodiimide hydrochloride (EDC) from Thermo Scientific were dissolved in 18 MOhm DDW immediately before use ...
-
bioRxiv - Bioengineering 2022Quote: ... 1-ethyl-3-(−3-dimethylaminopropyl) carbodiimide hydrochloride (EDC) was purchased from Fisher Scientific (Pittsburgh, PA, USA). 2-Bromo-2-methylpropionic acid (BMPA) ...
-
bioRxiv - Biophysics 2019Quote: ... 4-(2-(6-(dibutylamino)-2-naphthalenyl)ethenyl)-1-(3-sulfopropyl)-,hydroxide (di-4-ANEPPS) was purchased from Invitrogen. It was dissolved in ethanol and added to the dried lipid film at a 12:1 lipid:probe molar ratio ...
-
bioRxiv - Systems Biology 2023Quote: ... 10 mM tris (2-carboxyethyl) phosphine hydrochloride (TCEP; Thermo Scientific) and 40 mM chloroacetamide (CAA ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2:6 and 3:6 dilution ratios to allow efficient selection of Hygromycin B (Thermo Fisher Scientific Catalog Number: 10687010). The Hygromycin selection was started at the 48 hours after transfection time point with a final concentration of 150µg/ml and refreshed every 3-4 days until the control non-transfected cells on a separate plate were completely dead (takes approximately 3 weeks from the start of transfection until the cells are expanded and frozen) ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were counterstained with Fluoro-gel II containing DAPI (Fluoro-Gel, Fisher Scientific Intl INC, PA). Immunostaining images were taken using a Leica inverted microscope with a TCS SPEII confocal module and processed using LAS X software (Leica Microsystems Inc ...
-
bioRxiv - Cell Biology 2021Quote: ... washed 3 times and incubated with 4’,6-Diamidino-2-phenylindole (DAPI; 2mg/ml) (Invitrogen) in PBS for 5 minutes ...
-
bioRxiv - Cell Biology 2020Quote: ... After washing and nuclear counterstaining with 4’,6-diamidino-2-phenylindole (DAPI, ThermoFisher, 3 µM), sections were mounted on microscopic slides using Aqua Poly/Mount (Polysciences) ...
-
bioRxiv - Microbiology 2019Quote: ... 1 mM Tris(2-carboxyethyl)phosphine hydrochloride (TCEP-HCl, ThermoFisher Scientific), and 250 μg/mL DNase ...
-
bioRxiv - Cell Biology 2019Quote: ... and subsequently derivatized with 2% (w/v) methoxyamine hydrochloride (Thermo Scientific) in pyridine for 60 min following by 30 min sialyation N-tertbutyldimethylsilyl-N-methyltrifluoroacetamide (MTBSTFA ...
-
bioRxiv - Biochemistry 2023Quote: ... Tris(2-carboxyethyl)phosphine hydrochloride (TCEP; #20490) was obtained from ThermoFisher Scientific ...
-
bioRxiv - Bioengineering 2021Quote: ... Celsus Laboratories) was reacted with peptide-hydrazides using 1-ethyl-3-[3-dimethylaminopropyl] carbodiimide hydrochloride (EDC, ThermoFisher Scientific) in 0.1 M MES [2-(N-morpholino)ethanesulfonic acid] buffer with 8 M urea (Sigma ...
-
bioRxiv - Biochemistry 2020Quote: ... 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride (EDC) and N-hydroxysulfosuccinimide (Sulfo-NHS) were obtained from Thermo Fisher Scientific (Waltham ...
-
bioRxiv - Microbiology 2022Quote: 3×10^6 S2 cells (Invitrogen)/well were plated on a 6-well plate in Complete Schneider’s media supplemented with 10% FBS and pen/strep (CS10PS) ...
-
bioRxiv - Biophysics 2023Quote: ... λex = 561 nm (Fluoro-Max; Fisher Scientific), 40 nm diameter dark red bead ...
-
bioRxiv - Neuroscience 2021Quote: ... Nucleus staining was performed using 4’,6-diamidino-2-phenylindole (DAPI) (3 mM, D3571, Molecular Probes). Cells were counted from four randomly selected fields per culture under a confocal microscope (TCS SP8 ...
-
bioRxiv - Biochemistry 2021Quote: ... 2-[6-(4’-hydroxy) phenoxy-3H-xanthen-3-on-9-yl] benzoate (HPF) from Molecular Probes® and Horse radish peroxidase (HRP ...
-
bioRxiv - Physiology 2021Quote: 2-3 viable human slices were incubated with Fluo4-AM (6 μM, Invitrogen cat. No. F1221) for 1h in 3 mM HEPES buffer (125 mmol/l NaCl ...
-
bioRxiv - Cell Biology 2023Quote: ... for 30 min at room temperature using 10 mM Sodium Acetate [pH 5.0] buffer containing 5μg/ml 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDC, Thermofisher, 22980) as coupling agent ...
-
bioRxiv - Systems Biology 2023Quote: ... We blocked cysteine residues using 2 mM Tris (2-carboxyethyl) phosphine hydrochloride (TCEP) (Thermo Fisher Scientific) at 37 °C for 30 min followed by alkylation with 10 mM 2-iodoacetamide (IAA ...
-
bioRxiv - Cell Biology 2020Quote: ... and 10 mM tris(2-carboxyethylphosphine hydrochloride (TCEP; BondBreaker, Thermo Fisher Scientific) for 5 minutes at 99 °C with 1500 rpm shaking followed by 15 minutes sonication in a water bath sonicator ...
-
bioRxiv - Neuroscience 2020Quote: ... Proteins were reduced with 5mM Tris(2-carboxyethyl) phosphine hydrochloride (Thermo Fisher) for 30 min and alkylated with 10 mM iodoacetamide (Sigma Aldrich ...
-
bioRxiv - Cancer Biology 2021Quote: ... Culture medium was refreshed every 2–3 days and organoids were passaged 1:2–1:6 every 7–21 days using TrypLE Express (Thermo Fisher). For co-culturing ...
-
bioRxiv - Neuroscience 2021Quote: ... and immersed in reagent-2 (diluted 1:2 in PBS) for 6-24 h before incubated in reagent-2 containing TO-PRO-3 (1:5,000, Thermo Fisher Scientific) for additional 7-10 days ...
-
bioRxiv - Biochemistry 2019Quote: ... and N-ethyl-N-(3-dimethyl aminopropyl) carbodiimide hydrochloride (EDC) (Thermo Fisher Scientific, USA) were mixed in a reaction flask ...
-
Volumetric Compression Shifts Rho GTPase Balance and Induces Mechanobiological Cell State TransitionbioRxiv - Biophysics 2023Quote: ... were coated with 1.8 mg/mL 3-hydroxytyramine hydrochloride (or dopamine-HCl, Acros Organics) in 10mM Tris-HCl buffer (pH 8.5 ...
-
bioRxiv - Cell Biology 2022Quote: ... The eluted beads were then treated with 6 M guanidine hydrochloride (GdnHCl; [Thermo Fisher Scientific; 24115]) and incubated for 2 hrs at room temperature with mixing ...
-
bioRxiv - Cell Biology 2021Quote: ... 6′-diamidino-2-phenylindole (Invitrogen). All observations were performed on a Nikon E600 epifluorescence microscope ...
-
bioRxiv - Physiology 2022Quote: ... An aliquot of 100 μL was subsequently derivatized using a final concentration of 10 mM aniline and 5 mM 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDC) (ThermoFisher) for 2 h at 4 °C ...
-
bioRxiv - Immunology 2020Quote: ... 25 μl/well of 60 mM water solution of 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride (EDC, Thermo Fisher Scientific) were added ...
-
bioRxiv - Neuroscience 2023Quote: ... The carboxylic groups on the carbon fiber surface were electro-activated by incubation in 0.4 M 1-ethyl-3-[3-dimethylaminopropyl] carbodiimide hydrochloride (EDC; Life Technologies) and 0.1 M and N-hydroxysulfosuccinimide (NHSS ...
-
bioRxiv - Bioengineering 2024Quote: ... 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDC) (Cat. A638729) were purchased from Aladdin (Shanghai). KLH (Cat. 77600) was purchased from ThermoFisher. Peptide synthesis was conducted by Genscript (Nanjing ...
-
bioRxiv - Molecular Biology 2023Quote: U2OS 2-6-3 cells (Shanbhag et al., 2010) were cultured in McCoy’s 5A (Modified) Medium (Gibco) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Cell Biology 2023Quote: ... DAPI (4’,6-Diamidino-2-henylindole, dihydrochloride) was obtained from Invitrogen (Catalog: D1306, CAS:28718-90-3).
-
bioRxiv - Neuroscience 2020Quote: ... Proteins were reduced with 5 mM Tris(2-carboxyethyl) phosphine hydrochloride (Thermo Fisher) for 30 min and alkylated with 10 mM iodoacetamide (Sigma Aldrich ...
-
bioRxiv - Biochemistry 2022Quote: ... TCEP HCl (Tris (2-carboxy ethyl phosphine) hydrochloride) was purchased from Thermo Scientific. All salts for buffers and reagents were of research grade and high purity ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... Proteins were reduced with 5 mM Tris (2-carboxyethyl) phosphine hydrochloride (Thermo Fisher) for 30 min and alkylated with 10 mM iodoacetamide (Sigma Aldrich ...
-
bioRxiv - Biochemistry 2019Quote: ... reduced with 5 mM Tris(2-carboxyethyl)phosphine hydrochloride (TCEP-HCl, Thermofisher Scientific) and then digested with 100 μg of Lys-C (Wako ...
-
bioRxiv - Molecular Biology 2020Quote: ... antibodies were reduced using TCEP (Tris(2-carboxyethyl)phosphine hydrochloride) (Thermo Fisher, # 77720) according to manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... Proteins were reduced with 5 mM tris(2-carboxyethyl)phosphine hydrochloride (Thermo Fisher) for 30 min and alkylated with 10 mM iodoacetamide (Sigma Aldrich ...