Labshake search
Citations for Thermo Fisher :
51 - 100 of 10000+ citations for 6 Chloro 3 nitro 2 trifluoromethyl pyridine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... SUMO-2/3 (Invitrogen); β-Catenin (BD Transduction Laboratories) ...
-
bioRxiv - Microbiology 2019Quote: ... and 3-6 μl Lipofectamin 2000 (Life Technologies). See the Supplemental Information for detailed description.
-
bioRxiv - Immunology 2020Quote: ... and QuantStudio 3 or 6 Flex (ThermoFisher Scientific) following manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2020Quote: ... 6-diamidino-2-phenylindole (DAPI; Invitrogen). Slides were mounted in ProLong® Gold antifade reagent (Invitrogen ...
-
bioRxiv - Cancer Biology 2022Quote: ... 6-diamidino-2-phenylindole (DAPI, Invitrogen) was used for nuclear counterstaining ...
-
bioRxiv - Cell Biology 2019Quote: ... 6-diamidino-2-phenylindole (DAPI) (Invitrogen) in SC-LEU media for 45-60 minutes to stain nuclear or mitochondrial DNA (Hanna et al. ...
-
bioRxiv - Developmental Biology 2022Quote: ... 6-diamidino-2-phenylindole (DAPI, Invitrogen). After PBS washing ...
-
bioRxiv - Neuroscience 2023Quote: ... 6-diamidino-2-phenylindole (DAPI, Invitrogen) nuclear stain ...
-
bioRxiv - Developmental Biology 2023Quote: ... 6-diamidino-2-phenylindole (DAPI; Invitrogen) and mounted with FluoromountG (SouthernBiotech).
-
bioRxiv - Developmental Biology 2024Quote: ... 6-diamidino-2-phenylindole (DAPI, Invitrogen). After washing slides were mounted in Elvanol ...
-
bioRxiv - Cancer Biology 2021Quote: ... cells were marked with 2,3×10−3 μg/μL 4’,6-Diamidino-2-phenylindole dihydrochloride (DAPI, Thermo Fisher Scientific) for 10 minutes at room temperature in the dark ...
-
bioRxiv - Cell Biology 2023Quote: ... No mycoplasma were detected in cultures by 4′,6-diamidino-2-phenylindole or TO-PRO-3 (Thermo Fisher Scientific) staining.
-
bioRxiv - Immunology 2019Quote: ... and Para-nitro-phenyl-phosphatase (PNPP) (Thermo Fisher Scientific, USA) substrate ...
-
Turanose induced WOX5 restores symbiosis in the Medicago truncatula cytokinin perception mutant cre1bioRxiv - Plant Biology 2020Quote: ... and immersed and incubated in the dark in staining solution 1 mM 5-bromo-4-chloro-3-indolyl-β-D-glucuronicacid (X-Gluc, Thermo Scientific), 50mM sodium phosphate buffer ...
-
bioRxiv - Plant Biology 2019Quote: To assess GUS expression driven by the maize ubiquitin promoter in transgenic barley transformed with the pBRACT214m-GUS construct we collected different tissues and stained these with 1mg/ml of X-gluc (5-bromo-4-chloro-3-indolyl-B-D-glucuronic acid, Thermo Scientific, USA) in X-gluc buffer (100mM sodium phosphate buffer pH 7.0 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 7H11 plates contained 50 μg/mL hygromycin and 50 μM 5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside (X-gal) (Thermo Scientific). Unless specified ...
-
bioRxiv - Synthetic Biology 2024Quote: ... 100 μM isopropyl-β-D-thiogalactopyranoside (IPTG) and 100 μg/mL 5-bromo-4-chloro-3-indolyl-beta-D-galacto-pyranoside (X-gal) (Thermo Fisher Scientific). After incubation overnight at 37 °C ...
-
bioRxiv - Microbiology 2024Quote: ... Plates were washed five times with PBS and then twice with distilled water (dH2O) before addition of 5-bromo-4-chloro-3-indolyl-phosphate/NBT (BCIP/NBT) one-step solution (Thermo Fisher Scientific) and incubation at 37°C for approximately 15 minutes ...
-
bioRxiv - Cancer Biology 2023Quote: ... then adding 15 µL of methoxy amine in pyridine (MOX) (Thermo Fisher) and incubating at 40°C for 90 min ...
-
bioRxiv - Neuroscience 2021Quote: ... DiIC18(3) dye (6 mg; Invitrogen, Carlsbad, CA, USA) was dissolved in 99.5% methylene chloride (300 μL ...
-
bioRxiv - Developmental Biology 2020Quote: ... 6-diamidino-2-phenylindole (DAPI, ThermoFisher Scientific). Cells were imaged using a Zeiss Axio fluorescence microscope.
-
bioRxiv - Neuroscience 2021Quote: ... 6 diamidino-2-phenylindole dihydrochloride (DAPI; Invitrogen) for 3 min and washed ...
-
bioRxiv - Microbiology 2019Quote: ... 6’-diamidino-2 phenylindole (DAPI) (Life Technologies), and visualized on a Nikon TiE fluorescent microscope using 60X oil immersion objective ...
-
bioRxiv - Bioengineering 2021Quote: ... 6-Diamino-2-Phenylindole (DAPI, ThermoFisher, USA). The staining solution was then washed with PBS.
-
bioRxiv - Bioengineering 2020Quote: ... DAPI ((4’,6-diamidino-2 phenylindole, Invitrogen) was added and samples were covered with coverslips ...
-
bioRxiv - Microbiology 2019Quote: ... 6-diamidino-2-phenylindole (DAPI) (Life Technologies) at 0.1 ng/ml ...
-
bioRxiv - Developmental Biology 2022Quote: ... 6-diamidino-2-phenylinodole (DAPI; Molecular Probes). Images were acquired on a DeltaVision Elite microscope using a 60X ...
-
bioRxiv - Developmental Biology 2022Quote: ... 4’,6-diamidino-2-phenylindole (DAPI, Invitrogen) was added to embryos (10 μg/mL in PBST ...
-
bioRxiv - Synthetic Biology 2020Quote: ... 6 mM L-glutamine (2 mM, Gibco #31600-091 ...
-
bioRxiv - Microbiology 2020Quote: ... 6-di-amidino-2-phenylindole (DAPI; Invitrogen) on a glass slide ...
-
bioRxiv - Bioengineering 2022Quote: ... 4’,6-diamidino-2-phenylindole (DAPI; Invitrogen) allowed visualization of the nucleus (1:5000 dilution) ...
-
bioRxiv - Neuroscience 2023Quote: ... 6-diamidino-2-phenylindole (DAPI) from ThermoFisher; anti-mouse IgG-horse radish peroxidase (HRP) ...
-
Flaviviruses alter endoplasmic reticulum-mitochondria contacts to regulate respiration and apoptosisbioRxiv - Microbiology 2023Quote: ... 6’-diamidino-2-phenylindole (DAPI; Life Technologies) diluted 1/10,000 for nuclei staining ...
-
bioRxiv - Cancer Biology 2023Quote: ... 6-diamidino-2-phenylindole (DAPI) (ThermoFisher, #D1306) at a concentration of 10 µg/ml in PBS / 3.0%BSA for 15 minutes then rinsed 3x 5 minutes in distilled water ...
-
bioRxiv - Microbiology 2023Quote: ... 6’-diamidino-2-phenylindole (DAPI; Life Technologies) diluted 1:10000 in PBS ...
-
bioRxiv - Cell Biology 2019Quote: ... Slides were washed 3 × 10 min with PBS and nuclei stained with 1 µg/mL 4’,6-diamidino-2-phenylindole (DAPI, Invitrogen) in PBS for 15 min ...
-
bioRxiv - Cancer Biology 2019Quote: 4T1 and 67NR cells at 70-80% confluence were transfected with the shRNA constructs described above in FuGene 6 at a ratio of 3:2 per manufacturer’s instructions (Thermo Fisher). Pools of transfected cells were selected in media with 7 µg/ml puromycin ...
-
bioRxiv - Systems Biology 2022Quote: ... Transcriptomics using the isolated mRNA from liver tissues (0, 2, 4, 6, 8 and 10 weeks; n=3 per time point) was performed by Affymetrix GeneChip®Mouse Gene 2.0 ST Arrays (902118) ...
-
bioRxiv - Biochemistry 2021Quote: ... 1-O-(6-BODIPY®558/568-aminohexyl)-2-BODIPY®FL C5-sn-glycero-3-phosphocholine (Thermo Fisher Scientific) as described previously [38] ...
-
bioRxiv - Genomics 2023Quote: The PPMI iPSC lines were thawed and grown on matrigel (Corning)-coated plates with Essential 8 Flex (E8, Batches 1, 2 and 3) or Essential 6 (E6, Batches 4 and 5) media (both Gibco) for about one month (5 passages) ...
-
bioRxiv - Biochemistry 2023Quote: ... 3 x 5 min) on a rocking platform and stained with 4′,6-diamidino-2- phenylindole dihydrochloride (DAPI) (Life Technologies) staining (2 μM ...
-
bioRxiv - Cell Biology 2024Quote: ... 20 ng/mL TPO and 40 ng/mL IL-3 from day 1 to day 6 with a media refresh every 2 days (all cytokines from Thermofisher). On day 8 ...
-
bioRxiv - Microbiology 2020Quote: ... 10 ml l1 glycerol and 20 g l−1 Bacto agar) supplemented with 25 µg ml−1 5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside (X-gal, Thermo Fisher Scientific). Overnight cultures of the control strains were normalized to OD600 = 1.0 and inoculated as 20 µl spots on the agar plates containing the biosensor ...
-
bioRxiv - Cell Biology 2024Quote: ... Samples were then dried at 100°C and derivatized with 7-chloro-4-nitrobenzo-2-oxa-1,3-diazole (Acros Organics, ThermoFisher Scientific) prior to reverse-phase HPLC (Agilent 1100 series ...
-
bioRxiv - Cell Biology 2024Quote: ... The flow-through was then dried in a speed-vac and derivatized with 7-chloro-4-nitrobenzo-2-oxa-1,3-diazole (Acros Organics, ThermoFisher Scientific) prior to reverse-phase HPLC (Agilent 1100 series ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Methanol (CH3OH) 99.8% and pyridine 99.5% were purchased from Acros Organics (Geel, Belgium). 1,2-Distearoyl-sn-Glycero-3-Phosphocholine (DSPC ...
-
bioRxiv - Cell Biology 2021Quote: ... were transiently transfected into 8 × 104 U2OS 2-6-3 cells in 4-well chamber slides using Lipofectamine 2000 reagent (Invitrogen, 11668019) according to the manufacturer’s instructions.
-
bioRxiv - Microbiology 2023Quote: ... Total DNA was stained using 4’,6-diamidino-2- phenylindole (DAPI) diluted 1:10000 in PBS containing 3% BSA (Molecular Probes) to illuminate host cell nuclei ...
-
bioRxiv - Cancer Biology 2023Quote: ... and TNFα (10 ng/ml) for 6 h and stained for cleaved Caspase 3/7 green (5 µM) and propidium iodide (2 µM) (Thermo Scientific) for an additional 30 min ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies) ...