Labshake search
Citations for Thermo Fisher :
1 - 50 of 10000+ citations for 6 Chloro 3 nitro 2 trifluoromethyl pyridine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2020Quote: Before staining with either 5-bromo-4-chloro-3’-indolyphosphate and nitro-blue tetrazolium (BCIP/NBT, ThermoFisher) or Alizarin Red S (ARS ...
-
bioRxiv - Immunology 2023Quote: ... 5-bromo-4-chloro-3-indolyl phosphate (BCIP)/nitro blue tetrazolium (NBT) substrate (Thermo Fisher Scientific, cat.: 34042) was added and the reaction was terminated after 5 min under running tap water ...
-
bioRxiv - Developmental Biology 2021Quote: ... Alkaline phosphatase staining was performed using the one-step nitro-blue tetrazolium (NBT) and 5-bromo-4-chloro-3’-indolyphosphate p-toluidine salt (BCIP) solution (Thermofisher).
-
bioRxiv - Immunology 2021Quote: ... The final wash was followed by the addition of Nitro-blue Tetrazolium Chloride/5-bromo-4-chloro 3 ‘indolyl phosphate p-toludine salt (NBT/BCIP chromagen) substrate solution (Thermo Scientific) for 7 min ...
-
bioRxiv - Microbiology 2021Quote: ... ACMA stands for 9-amino-6-chloro-2-methoxyacridine (A1324, ThermoFisher Scientific). For each measurement in the spectrofluorometer (Hitachi F-7000) ...
-
bioRxiv - Biochemistry 2022Quote: ... The quality of obtained microsomes was tested with 9-amino-6-chloro-2-methoxyacridine (ACMA; Invitrogen A1324) fluorescence quenching assays.
-
bioRxiv - Synthetic Biology 2019Quote: ... 1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine-N-(7-nitro-2-1,3-benzoxadiazol-4-yl) was purchased from Invitrogen. Calcein dye ...
-
bioRxiv - Cancer Biology 2020Quote: ... Proton transport was measured using ATP-dependent quenching of 9-amino-6-chloro-2-methoxy-acridine (Acridine Orange, ThermoFisher) fluorescence quenching for isolated vacuoles as previously described21
-
bioRxiv - Bioengineering 2022Quote: ... 1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine-N-(7-nitro-2-1,3-benzoxadiazol-4-yl) (16:0 NBD) were purchased from Invitrogen. Phosphate-buffered saline (PBS ...
-
bioRxiv - Microbiology 2021Quote: ... Samples were then treated with hexamethyldisilazane-trimethylchlorosilane-pyridine solution (3:1:9; ThermoFisher) for 20 min at 110°C ...
-
bioRxiv - Systems Biology 2019Quote: ... in pyridine (Acros Organics) and then by N-methyl-N-(trimethylsilyl ...
-
bioRxiv - Developmental Biology 2021Quote: ... 2-deoxy-2-[(7-nitro-2,1,3-benzoxadiazol-4-yl)amino]- D-glucose (2-NBDG) (Invitrogen N13195) was used as a probe for monitoring glucose uptake ...
-
bioRxiv - Physiology 2022Quote: ... Mitochondria membrane polarization was measured by loading cells with 2 µM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, 15003) at 37°C for 15 min ...
-
bioRxiv - Neuroscience 2020Quote: ... and 0.175 g/ml 5-bromo-4-chloro-3-indolyl-phosphate (BCIP) (Invitrogen). Alkaline phosphatase staining reaction was proceeded o/n at RT ...
-
bioRxiv - Neuroscience 2023Quote: ... DAPI (4′,6-diamidino-2-phenylindole, 3 uM final) (Invitrogen, D1306) was used to stain the DNA content of cells so that doublets and debris could be removed by sorting on the DAPI height vs DAPI area ...
-
bioRxiv - Neuroscience 2020Quote: ... Cells were then passaged 1:3-1:6 every 2-3 days using Accutase (Gibco).
-
bioRxiv - Biochemistry 2021Quote: ... Fluorescence-labelled 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine-N-(7-nitro-2-1,3-benzoxadiazol-4-yl) (NBD-PE) was obtained from Molecular Probes (Eugene, Oregon, US). Sucrose was purchased from XiLong Chemical Co. ...
-
bioRxiv - Biochemistry 2020Quote: ... in pyridine (Thermo Fisher Scientific, 25104) at 60 °C for 1 h ...
-
bioRxiv - Bioengineering 2022Quote: ... and 4-(dimethylamino)pyridine (Fisher Scientific) (3:1 to HA-TBA repeat unit ...
-
bioRxiv - Molecular Biology 2022Quote: ... cells were incubated in 2 μM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, cat no: T3168) at 37°C for 15 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μM of oligonucleotide labeled with 6-carboxyfluorescein (6-FAM) at the 5’ end (5’– AACGACGGCCAGTGAATCCGTAATCATGGT–3’, Invitrogen), 50 μM each dNTP ...
-
bioRxiv - Bioengineering 2023Quote: ... and then Pyridine (0.02 mol; Fisher Scientific) was injected to the mixture ...
-
bioRxiv - Microbiology 2021Quote: ... 40 μg/mL 5-bromo-4-chloro-3-indolyl-beta-D-galactopyranoside (X-Gal) (Thermo Scientific) and 1 mM isopropyl beta-D-thiogalactopyranoside (IPTG ...
-
bioRxiv - Biophysics 2019Quote: ... 4-(2-(6-(dibutylamino)-2-naphthalenyl)ethenyl)-1-(3-sulfopropyl)-,hydroxide (di-4-ANEPPS) was purchased from Invitrogen. It was dissolved in ethanol and added to the dried lipid film at a 12:1 lipid:probe molar ratio ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2:6 and 3:6 dilution ratios to allow efficient selection of Hygromycin B (Thermo Fisher Scientific Catalog Number: 10687010). The Hygromycin selection was started at the 48 hours after transfection time point with a final concentration of 150µg/ml and refreshed every 3-4 days until the control non-transfected cells on a separate plate were completely dead (takes approximately 3 weeks from the start of transfection until the cells are expanded and frozen) ...
-
bioRxiv - Biochemistry 2023Quote: ... in pyridine (CAS#25104, Thermo scientific, Rockford, IL) and stirred at 90 ° C for 1.5 hours ...
-
bioRxiv - Microbiology 2021Quote: ... and 40 µg/mL X-Gal (5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside; Thermo Scientific). Plates were incubated at room temperature for 48-72 h ...
-
bioRxiv - Microbiology 2024Quote: ... containing 100 mg/ml of X-gal (5-Bromo-4-chloro-3-indolyl β-D-galactopyranoside) (Thermofisher) to confirm CFU/ml counts.
-
bioRxiv - Physiology 2024Quote: ... / bromo-chloro-indolyl phosphate (Thermo Scientific) in AP buffer or using Naphtol AS-MX phosphate and Fast Red (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2021Quote: ... washed 3 times and incubated with 4’,6-Diamidino-2-phenylindole (DAPI; 2mg/ml) (Invitrogen) in PBS for 5 minutes ...
-
bioRxiv - Cell Biology 2020Quote: ... After washing and nuclear counterstaining with 4’,6-diamidino-2-phenylindole (DAPI, ThermoFisher, 3 µM), sections were mounted on microscopic slides using Aqua Poly/Mount (Polysciences) ...
-
bioRxiv - Immunology 2024Quote: ... Dried polar metabolites were dissolved in 15 μL of 2% methoxyamine hydrochloride in pyridine (Thermo Fisher Scientific, 25104) at 55°C ...
-
bioRxiv - Microbiology 2022Quote: 3×10^6 S2 cells (Invitrogen)/well were plated on a 6-well plate in Complete Schneider’s media supplemented with 10% FBS and pen/strep (CS10PS) ...
-
bioRxiv - Plant Biology 2024Quote: ... or X-Gal (5-bromo-4-chloro-3-indolyl-b-D-galactopyranoside, W5376C; Thermo Fisher Scientific, Guilford, CT). GUS and/or LacZ-stained tissues were cleared for 30 s with 12 % sodium hypochlorite solution before microscopy observations.
-
bioRxiv - Neuroscience 2021Quote: ... Nucleus staining was performed using 4’,6-diamidino-2-phenylindole (DAPI) (3 mM, D3571, Molecular Probes). Cells were counted from four randomly selected fields per culture under a confocal microscope (TCS SP8 ...
-
bioRxiv - Biochemistry 2021Quote: ... 2-[6-(4’-hydroxy) phenoxy-3H-xanthen-3-on-9-yl] benzoate (HPF) from Molecular Probes® and Horse radish peroxidase (HRP ...
-
bioRxiv - Physiology 2021Quote: 2-3 viable human slices were incubated with Fluo4-AM (6 μM, Invitrogen cat. No. F1221) for 1h in 3 mM HEPES buffer (125 mmol/l NaCl ...
-
bioRxiv - Cancer Biology 2021Quote: ... Culture medium was refreshed every 2–3 days and organoids were passaged 1:2–1:6 every 7–21 days using TrypLE Express (Thermo Fisher). For co-culturing ...
-
bioRxiv - Neuroscience 2021Quote: ... and immersed in reagent-2 (diluted 1:2 in PBS) for 6-24 h before incubated in reagent-2 containing TO-PRO-3 (1:5,000, Thermo Fisher Scientific) for additional 7-10 days ...
-
bioRxiv - Neuroscience 2021Quote: ... a staining solution of 1 mg/mL 5-bromo-4-chloro-3-indolyl-beta-d-galactopyranoside (X-gal, Invitrogen), 1× citratesodium phosphate buffer (pH 6.0) ...
-
bioRxiv - Cell Biology 2021Quote: ... 6′-diamidino-2-phenylindole (Invitrogen). All observations were performed on a Nikon E600 epifluorescence microscope ...
-
bioRxiv - Molecular Biology 2023Quote: U2OS 2-6-3 cells (Shanbhag et al., 2010) were cultured in McCoy’s 5A (Modified) Medium (Gibco) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Cell Biology 2023Quote: ... DAPI (4’,6-Diamidino-2-henylindole, dihydrochloride) was obtained from Invitrogen (Catalog: D1306, CAS:28718-90-3).
-
bioRxiv - Microbiology 2023Quote: ... was used for induction of gene expression and X-gal (X-Gal 5-Bromo-4-chloro-3-indolyl-b-D-galactopyranoside; Thermofisher) TSA plates were used for bacterial assessment ...
-
bioRxiv - Immunology 2022Quote: ... membranes were washed three times with PBS-T and then incubated with appropriate secondary antibody conjugated with alkaline phosphatase that provides a visual color change upon addition of the chromogenic substrate (mixture of BCIP (5-bromo-4chloro-3-indolyl phosphate-catalog# 34040) and NBT (nitro-blue tetrazolium chloride, catalog# 34035 from Thermo Scientific)).
-
bioRxiv - Neuroscience 2022Quote: ... the cerebral cortexes from 2-3 P3-P5 C57BL/6 mice were collected in ice cold HBSS (Invitrogen), the tissue was washed three times with HBSS and digested with 0.04% trypsin (Sigma ...
-
bioRxiv - Genomics 2023Quote: ... All nuclei were pooled and stained with DAPI (4′,6-diamidino-2-phenylindole, 3 uM final) (Invitrogen, D1306). Using a FACSAria III cell sorter (BD Biosciences) ...
-
bioRxiv - Biophysics 2023Quote: ... in 3% BSA with a 1:50 ratio and 4’,6-diamidino-2-phenylindole (DAPI, Thermo Fisher Scientific) were employed ...
-
bioRxiv - Biochemistry 2023Quote: ... cells were marked with 2,3x10-3 µg/µL 4’,6-Diamidino-2-phenylindole dihydrochloride (DAPI, Thermo Fisher Scientific) for 10 min at RT in the dark ...
-
bioRxiv - Physiology 2023Quote: The dried polar extracts were prepared for GC-MS analysis through solubilization in 40 µL of 2% methoxyamine hydrochloric acid in pyridine (Fisher Scientific) at 60°C for 60 min and derivatization with 60 µL of N-tertbutyldimethylsilyl-N-methyltrifluoroacetamide (MTBSTFA ...