Labshake search
Citations for Thermo Fisher :
201 - 250 of 10000+ citations for 6 CHLORO 3 ETHYL 2 PROPYL QUINOLINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... Cells were washed 3 times in PBST and mounted in 4′,6-diamidino-2-phenylindole (DAPI)-containing ProLong Anti-fade Diamond mountant (Thermo Fisher Scientific).
-
bioRxiv - Neuroscience 2020Quote: ... The samples were washed again in PBS for 3×15 min and mounted in DAPI (4-,6-diamidino-2-phenylindole; Life Technologies, D1306) for 5 min ...
-
bioRxiv - Neuroscience 2022Quote: ... were loaded at 3 μl/min for 6 min onto a 2 cm × 75 μm C18 trap column (Acclaim Pepmap 100, 3 μm, 300 Å, Thermo Scientific) in loading buffer (0.5% v/v formic acid ...
-
bioRxiv - Molecular Biology 2023Quote: ... Biotinylation of Htz1(V126C) was carried out using N-[6-(Biotinamido)hexyl]-3’-(2’-pyridyldithio)propionamide (HPDP-Biotin) (Thermo Fisher cat. # 21341), which has a pyridyl disulfide moiety ...
-
bioRxiv - Cell Biology 2022Quote: ... ethyl ester (TMRE, final concentration 20nM, Life Technologies) in the relevant medium for 10 min and analyzed by confocal microscopy (Takashima et al. ...
-
bioRxiv - Immunology 2020Quote: ... and ethyl ether were purchased from Fisher Scientific. Peptides were synthesized using automated Fmoc SPPS chemistry (Syro I) ...
-
bioRxiv - Microbiology 2023Quote: Ethyl acetate (EtOAc; J.T. Baker and Fisher Scientific) and Optima-grade methanol (MeOH ...
-
bioRxiv - Neuroscience 2023Quote: ... Tetramethylrhodamine ethyl ester (TMRE) was purchased from ThermoFisher; catalog no.T669.
-
bioRxiv - Cell Biology 2020Quote: ... and 2 mg/ml 4’,6-diamidino-2-phenylindole (DAPI, ThermoFisher Scientific, 11916621) for 1 hour ...
-
bioRxiv - Microbiology 2021Quote: ... adding 2 μg/mL DAPI (4’,6-diamidino-2-phenylindole; Thermo Fisher Scientific) and 1 μM QUMA-1 23 to the final wash ...
-
bioRxiv - Immunology 2023Quote: ... 2,2′-azino-bis-3-ethylbenzothiazoline-6-sulfonic acid solution (Invitrogen, 002024) was added to the wells as the coloring substate for HRP ...
-
bioRxiv - Developmental Biology 2021Quote: ... 4′,6-diamidino-2-phenylindole (DAPI) (Life Technologies #D1306) was used for nuclei staining in conjunction with secondary antibodies ...
-
bioRxiv - Neuroscience 2020Quote: ... 6-diamidino-2-phenylindole (DAPI; Invitrogen, Eugene, OR, USA). Quantification of GFAP ...
-
bioRxiv - Neuroscience 2020Quote: DAPI (4’,6-Diamidino-2-Phenylindole, Dihydrochloride) (Invitrogen, # D1306)
-
bioRxiv - Bioengineering 2020Quote: ... and 4′,6-diamidino-2-phenylindole (DAPI; Invitrogen D1306) for 30 min at room temperature.
-
bioRxiv - Cell Biology 2021Quote: ... DAPI (4’,6-Diamidino-2-Phenylindole, Dihydrochloride) (Invitrogen, D1306). Protein G–Sepharose (GE Healthcare ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 4’,6-diamidino-2-phenylindole (DAPI, ThermoFisher Scientific) staining according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2022Quote: ... 4’,6-diamidino-2-phenylindole (DAPI, Thermo Fisher Scientific) was then added immediately at a concentration of 1:1000 to label DNA ...
-
bioRxiv - Developmental Biology 2022Quote: ... or 4’,6-diamidino-2-phenylindole (DAPI, Molecular Probes) was applied as a nuclear counterstain ...
-
bioRxiv - Systems Biology 2022Quote: ... 6-Diamidino-2-phenylindole (DAPI) staining Hoechst (Invitrogen 33342) was used and added to the secondary antibody staining solution at a dilution of 1:500 ...
-
bioRxiv - Genomics 2019Quote: ... stained with 4’,6-diamidino-2-phenylindole (DAPI, Invitrogen) at a final concentration of 3 μM ...
-
bioRxiv - Molecular Biology 2021Quote: ... DAPI (4′,6-diamidino-2-phenylindole, dihydrochloride) (Thermo Fisher) at a dilution of 1:5,000 in 1x PBS was used to stain cell nuclei ...
-
bioRxiv - Zoology 2020Quote: ... 6’-diamidino-2-phenylindole (DAPI, Invitrogen, Carlsbad, CA, USA) in dd H2O for 20 min ...
-
bioRxiv - Physiology 2020Quote: ... 6-diamidino-2-phenylindole (DAPI, 1:25000, Thermo Fisher) diluted in PBS and mounted with Prolong Gold Antifade Medium (Invitrogen) ...
-
bioRxiv - Neuroscience 2021Quote: ... 4’,6-Diamadino-2-phenylindole (DAPI, 1:1000, Invitrogen) was incubated after secondary antibody incubation for 15 min at room temperature ...
-
bioRxiv - Developmental Biology 2021Quote: ... DAPI (4′,6-diamidino-2-phenylindole, ThermoFisher Scientific 62247) was used to counterstain the nuclei.
-
bioRxiv - Cell Biology 2019Quote: ... DAPI (4′,6-diamidino-2-phenylindole, dihydrochloride; Life Technologies) was used to counterstain cell nuclei ...
-
bioRxiv - Biophysics 2021Quote: ... 4′,6-diamidino-2-phenylindole (DAPI) (Life Technologies #D1306) was used for nuclei staining in conjunction with secondary antibodies ...
-
bioRxiv - Immunology 2022Quote: ... 6-diamidino-2-phenylindole (DAPI) (#P36931, Thermo Fisher Scientific) for nuclei counterstaing ...
-
bioRxiv - Developmental Biology 2022Quote: ... DAPI (4′,6-diamidino-2-phenylindole, ThermoFisher Scientific 62247) was used to counterstain the nuclei.
-
bioRxiv - Neuroscience 2023Quote: ... 4’,6-diamidino-2-phenylindole (DAPI) (Invitrogen, 1:1000), Mouse antiglial fibrillary acidic protein (GFAP ...
-
bioRxiv - Cell Biology 2023Quote: ... and 4’,6-diamidino-2-phenylindole (DAPI, Life Technologies). Whole-mount stained slices were then washed in PBS and incubated overnight in RapiClear 1.52 ...
-
bioRxiv - Bioengineering 2022Quote: ... LAURDAN (6-dodecanoyl-2-dimethylaminonaphthalene) was purchased from ThermoFisher Scientific ...
-
bioRxiv - Cancer Biology 2023Quote: ... with 4’,6-Diamidino-2-Phenylindole (DAPI, Invitrogen, D3571) 1:1000 in 1% BSA included in the second wash ...
-
bioRxiv - Bioengineering 2023Quote: ... and 4’,6-diamidino-2-phenylindole dihydrochloride (DAPI, Invitrogen) staining to visualize the cytoskeleton and nucleus ...
-
bioRxiv - Pathology 2023Quote: ... including 4’,6-Diamidino-2-Phenylindole (DAPI) (ThermoFisher, D1306), were prepared according to the manufacturer’s recommendation and applied to each section ...
-
bioRxiv - Developmental Biology 2022Quote: ... DAPI (4’,6-diamidino-2-phenylindole; Invitrogen REF: D1306) diluted at 1:1000 in PBT was added to the samples for 10 minutes at room temperature on a rotating wheel followed by a wash in PBT for 10 minutes ...
-
bioRxiv - Cell Biology 2023Quote: ... 4′,6-diamidino-2-phenylindole (DAPI, Thermo Fisher Scientific) was used at 0.2μM.
-
bioRxiv - Cancer Biology 2023Quote: ... 4’,6-diamidino-2-phenylindole (DAPI; Thermo Fisher Scientific) followed by an appropriate secondary Ab with Alexa Fluor 488 ...
-
bioRxiv - Microbiology 2023Quote: ... Laurdan (6-Dodecanoyl-2 Dimethylaminonaphthalene Thermo Fisher Scientific, MA) was dissolved in DMF (Sigma Aldrich ...
-
bioRxiv - Neuroscience 2024Quote: ... 4’,6-diamidino-2-phenylindole (DAPI; Invitrogen Corp., USA) was used for counterstaining ...
-
bioRxiv - Cell Biology 2024Quote: ... 4’,6-diamiino-2-phenylindole (DAPI; Invitrogen, Cat# D21490) diluted 1:1000 in PBS was applied for 15 minutes at room temperature with plates subsequently washed ...
-
bioRxiv - Microbiology 2024Quote: ... and 6 µL 2-mercaptoethanol (Fisher Chemical, Fisher Scientific) were added to a Qiagen powerbead tube ...
-
bioRxiv - Biophysics 2021Quote: ... at a ratio of 1:1.5:1.75:2 (FAM155A-3×FLAG:NALCN-1077-3×HA-GFP:UNC79-3×FLAG:UNC80-3×FLAG) using Lipofectamine 3000 (Thermo Fisher Scientific) and incubated for 40-48 hours ...
-
bioRxiv - Molecular Biology 2021Quote: ... We labeled the purified RLC with 10 molar excess of 5-((((2-Iodoacetyl)amino)ethyl)amino)naphthalene-1-sulfonic acid (IAEDANS, Invitrogen) or dabcyl C2 maleimide (AnaSpec ...
-
bioRxiv - Biochemistry 2024Quote: ... was labeled with the fluorescent probe 5-((((2-iodoacetyl)amino)ethyl)amino)naphthalene-1-sulfonic acid (1,5-IAEDANS from Molecular Probes) as previously described (17 ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies), and parasite burden was calculated based on the standard curve of known parasite contents(24).
-
bioRxiv - Microbiology 2019Quote: ... 2 mM 3-methyl-2-oxobutanoic acid (Fisher Scientific, Hampton, NH) and 1 mM acetyl-CoA (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2022Quote: ... 2 x10^6 in 6 cm dishes or 4 x10^6 in 10 cm dishes (Nunc Edge plates, Thermo Fisher Scientific) in conditioned NB or NB-Plus ...
-
bioRxiv - Neuroscience 2022Quote: ... 2 x10^6 in 6 cm dishes or 4 x10^6 in 10 cm dishes (Nunc Edge plates, Thermo Fisher Scientific) in conditioned NB or NB-Plus ...