Labshake search
Citations for Thermo Fisher :
1 - 50 of 10000+ citations for 6 CHLORO 3 ETHYL 2 PROPYL QUINOLINE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... ACMA stands for 9-amino-6-chloro-2-methoxyacridine (A1324, ThermoFisher Scientific). For each measurement in the spectrofluorometer (Hitachi F-7000) ...
-
bioRxiv - Cell Biology 2023Quote: ... The carboxyl groups on the bead surfaces were functionalized with amine-reactive groups via N- ethyl-N’-(3-(dimethylamino)propyl)carbodiimide (EDC) and sulfo-N-hydroxysuccinimide (sulfo-NHS, Thermo Fisher) crosslinking for 20 minutes at 4°C ...
-
bioRxiv - Cell Biology 2022Quote: ... For the bulk endocytosis experiments using the 4-[6-[4-(diethylamino)phenyl]-1,3,5-hexatrien-1-yl]-1-[3-(triethylammonio)propyl]-pyridiniumbromide dye (FM 4-64, Invitrogen), the cells were prepared as previously described [41] ...
-
bioRxiv - Biochemistry 2022Quote: ... The quality of obtained microsomes was tested with 9-amino-6-chloro-2-methoxyacridine (ACMA; Invitrogen A1324) fluorescence quenching assays.
-
bioRxiv - Neuroscience 2023Quote: Cultured neurons were incubated for 1 min with fluorescent dye N-(3-triethylammonium-propyl)-4-(6-(4-diethylamino)phenyl)-hexatrienyl)pyridinium dibromide (FM4-64; 4 µM; Invitrogen) and loaded by stimulation (10 Hz ...
-
bioRxiv - Immunology 2020Quote: ... and 1-Ethyl-3-(3-dimethylaminopropyl) carbodiimide (Thermo Fisher Scientific). The activated beads were washed three times with 50 mM MES pH 5.0 and added to SARS-CoV-2 S protein which was diluted in 50 mM MES pH 5.0 ...
-
bioRxiv - Immunology 2022Quote: ... and 1-Ethyl-3-(3-dimethylaminopropyl) carbodiimide (Thermo Fisher Scientific) and incubated for 30 min on a rotator at room temperature ...
-
bioRxiv - Bioengineering 2022Quote: ... and 0.02 mM 1-Ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDC) (Invitrogen). The reaction was allowed to proceed on a rotary incubator at room temperature for at least 4 hours ...
-
bioRxiv - Cell Biology 2019Quote: ... and 200 mM 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDAC) (Invitrogen) in water for 1 hour at 60°C ...
-
bioRxiv - Biophysics 2022Quote: ... 19 mg EDC (1-Ethyl-3-(3-dimethylaminopropyl)-carbodiimide) (Thermo Fisher), 11 mg sulfo-NHS (N-Hydroxysulfosuccinimide ...
-
bioRxiv - Immunology 2022Quote: ... 1.9g of ethyl-3-(3-dimethylaminopropyl)-carbodiimide hydrochloride (EDC) (ThermoFisher #22980) and 1.2g of N-hydroxysuccinimide (NHS ...
-
bioRxiv - Bioengineering 2023Quote: ... and 0.02 mM 1-Ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDC) (Invitrogen). The reaction was performed on a rotary incubator at room temperature for at least 4 hours ...
-
bioRxiv - Cancer Biology 2020Quote: ... Proton transport was measured using ATP-dependent quenching of 9-amino-6-chloro-2-methoxy-acridine (Acridine Orange, ThermoFisher) fluorescence quenching for isolated vacuoles as previously described21
-
bioRxiv - Neuroscience 2021Quote: ... Sections were washed and mounted in media (0.5% N propyl gallate, 70% glycerol, 1M tris pH8.0) containing 4′,6-diamidino-2-phenylindole (DAPI) (Invitrogen, Cat. No. D1306).
-
bioRxiv - Molecular Biology 2020Quote: ... 1-Ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDC) was purchased from Life Technologies/Thermo Fisher Scientific ...
-
bioRxiv - Bioengineering 2023Quote: ... 1-ethyl-3-(3-dimethyl-aminopropyl) carbodiimide (EDC; 22980) was purchased from Thermofisher Scientific (MA) ...
-
bioRxiv - Cancer Biology 2021Quote: ... AEC (3-amino-9-ethyl carbazole) chromogen (Thermo Fisher Scientific) was used ...
-
bioRxiv - Bioengineering 2023Quote: ... and EDC (1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride) were purchased from Thermo Fisher Scientific ...
-
bioRxiv - Physiology 2022Quote: ... Mitochondria membrane polarization was measured by loading cells with 2 µM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, 15003) at 37°C for 15 min ...
-
bioRxiv - Neuroscience 2020Quote: ... and 0.175 g/ml 5-bromo-4-chloro-3-indolyl-phosphate (BCIP) (Invitrogen). Alkaline phosphatase staining reaction was proceeded o/n at RT ...
-
bioRxiv - Neuroscience 2023Quote: ... DAPI (4′,6-diamidino-2-phenylindole, 3 uM final) (Invitrogen, D1306) was used to stain the DNA content of cells so that doublets and debris could be removed by sorting on the DAPI height vs DAPI area ...
-
bioRxiv - Neuroscience 2020Quote: ... Cells were then passaged 1:3-1:6 every 2-3 days using Accutase (Gibco).
-
bioRxiv - Bioengineering 2022Quote: Hydrogels for nanoindentation were fabricated on coverslips functionalized with 3-(Trimethoxysilyl)propyl methacrylate (Fisher Scientific) as previously described.[39] Briefly ...
-
bioRxiv - Biochemistry 2020Quote: Beads were first activated with 1-ethyl-3-[3-dimethylaminopropyl]carbodiimide hydrochloride (Thermo Fisher Scientific) in the presence of N-hydroxysuccinimide (Thermo Fisher Scientific) ...
-
bioRxiv - Neuroscience 2023Quote: ... 1-ethyl-3-[3-dimethylaminopropyl] carbodiimide hydrochloride (EDC) was obtained from Life Technologies (Carlsbad, CA) and N-hydroxysulfosuccinimide (NHSS ...
-
bioRxiv - Molecular Biology 2022Quote: ... cells were incubated in 2 μM JC-1 (5, 5’, 6, 6’-tetrachloro-1, 1’, 3, 3’-tetraethylbenzimidazolylcarbocyanine iodide, Invitrogen, cat no: T3168) at 37°C for 15 min ...
-
bioRxiv - Cell Biology 2021Quote: ... N-hydroxysulfosuccinimide (sulfo-NHS) and 1-ethyl-3-[3-dimethylaminopropyl]carbodiimide hydrochloride (EDC) from Thermo Scientific were dissolved in 18 MOhm DDW immediately before use ...
-
bioRxiv - Bioengineering 2022Quote: ... 1-ethyl-3-(−3-dimethylaminopropyl) carbodiimide hydrochloride (EDC) was purchased from Fisher Scientific (Pittsburgh, PA, USA). 2-Bromo-2-methylpropionic acid (BMPA) ...
-
bioRxiv - Microbiology 2022Quote: ... 10 µL n-propyl gallate solution (50 mg/mL n-propyl gallate (MP210274780, Thermo Fisher Scientific) and 16.3 mg/mL Tris base (648310 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μM of oligonucleotide labeled with 6-carboxyfluorescein (6-FAM) at the 5’ end (5’– AACGACGGCCAGTGAATCCGTAATCATGGT–3’, Invitrogen), 50 μM each dNTP ...
-
bioRxiv - Neuroscience 2022Quote: ... DiI (1,1’-Dioctadecyl-3,3,3’,3’-tetramethylindocarbocyanine perchlorate, dissolved in 70% ethyl-alcohol; Invitrogen), for fluorescent marking aimed to track their position post-mortem ...
-
bioRxiv - Cell Biology 2020Quote: ... 5 micromols sodium sulfo-NHS and 5 micromols 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC) (Thermo Fisher #22980) in 10 μL of DMSO ...
-
bioRxiv - Bioengineering 2021Quote: ... Celsus Laboratories) was reacted with peptide-hydrazides using 1-ethyl-3-[3-dimethylaminopropyl] carbodiimide hydrochloride (EDC, ThermoFisher Scientific) in 0.1 M MES [2-(N-morpholino)ethanesulfonic acid] buffer with 8 M urea (Sigma ...
-
bioRxiv - Immunology 2020Quote: ... and 50 µL of 50 mg/mL 1-ethyl-3-[3-dimethyl-aminopropyl]-carbodiimidehydrochloride (Thermo Fisher Scientific, 22981) were simultaneously added to the reaction tubes ...
-
bioRxiv - Biochemistry 2020Quote: ... 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide hydrochloride (EDC) and N-hydroxysulfosuccinimide (Sulfo-NHS) were obtained from Thermo Fisher Scientific (Waltham ...
-
bioRxiv - Immunology 2023Quote: ... 4.0 × 107 beads were activated with 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC, Thermo Fisher Scientific [TFS] 22980) and N-hydroxysuccinimide (NHS ...
-
bioRxiv - Cell Biology 2024Quote: ... 4.0 × 107 beads were activated with 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC, Thermo Fisher Scientific [TFS] 22980) and N-hydroxysuccinimide (NHS ...
-
bioRxiv - Microbiology 2021Quote: ... 40 μg/mL 5-bromo-4-chloro-3-indolyl-beta-D-galactopyranoside (X-Gal) (Thermo Scientific) and 1 mM isopropyl beta-D-thiogalactopyranoside (IPTG ...
-
bioRxiv - Biophysics 2019Quote: ... 4-(2-(6-(dibutylamino)-2-naphthalenyl)ethenyl)-1-(3-sulfopropyl)-,hydroxide (di-4-ANEPPS) was purchased from Invitrogen. It was dissolved in ethanol and added to the dried lipid film at a 12:1 lipid:probe molar ratio ...
-
bioRxiv - Molecular Biology 2020Quote: ... 2:6 and 3:6 dilution ratios to allow efficient selection of Hygromycin B (Thermo Fisher Scientific Catalog Number: 10687010). The Hygromycin selection was started at the 48 hours after transfection time point with a final concentration of 150µg/ml and refreshed every 3-4 days until the control non-transfected cells on a separate plate were completely dead (takes approximately 3 weeks from the start of transfection until the cells are expanded and frozen) ...
-
bioRxiv - Biochemistry 2019Quote: ... and N-ethyl-N-(3-dimethyl aminopropyl) carbodiimide hydrochloride (EDC) (Thermo Fisher Scientific, USA) were mixed in a reaction flask ...
-
bioRxiv - Cell Biology 2023Quote: ... for 30 min at room temperature using 10 mM Sodium Acetate [pH 5.0] buffer containing 5μg/ml 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDC, Thermofisher, 22980) as coupling agent ...
-
bioRxiv - Microbiology 2021Quote: ... and 40 µg/mL X-Gal (5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside; Thermo Scientific). Plates were incubated at room temperature for 48-72 h ...
-
bioRxiv - Bioengineering 2020Quote: Before staining with either 5-bromo-4-chloro-3’-indolyphosphate and nitro-blue tetrazolium (BCIP/NBT, ThermoFisher) or Alizarin Red S (ARS ...
-
bioRxiv - Microbiology 2024Quote: ... containing 100 mg/ml of X-gal (5-Bromo-4-chloro-3-indolyl β-D-galactopyranoside) (Thermofisher) to confirm CFU/ml counts.
-
bioRxiv - Physiology 2024Quote: ... / bromo-chloro-indolyl phosphate (Thermo Scientific) in AP buffer or using Naphtol AS-MX phosphate and Fast Red (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2021Quote: ... washed 3 times and incubated with 4’,6-Diamidino-2-phenylindole (DAPI; 2mg/ml) (Invitrogen) in PBS for 5 minutes ...
-
bioRxiv - Cell Biology 2020Quote: ... After washing and nuclear counterstaining with 4’,6-diamidino-2-phenylindole (DAPI, ThermoFisher, 3 µM), sections were mounted on microscopic slides using Aqua Poly/Mount (Polysciences) ...
-
bioRxiv - Microbiology 2020Quote: ... propyl iodide (PI) and Hoechst from Thermo Fisher Scientific ...
-
bioRxiv - Physiology 2022Quote: ... An aliquot of 100 μL was subsequently derivatized using a final concentration of 10 mM aniline and 5 mM 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDC) (ThermoFisher) for 2 h at 4 °C ...