Labshake search
Citations for Thermo Fisher :
251 - 300 of 10000+ citations for 5 tert butoxy 5 oxopentanoic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... Leukocytes were washed with cold PBS followed by another centrifugation step (300 x g 5 minutes) and resuspended in 5 mL of 5 μg mL-1 of Hoechst 33342 (Thermo Fisher Scientific) diluted in warm PBS ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies), and parasite burden was calculated based on the standard curve of known parasite contents(24).
-
bioRxiv - Pathology 2023Quote: ... one lung section 5×5×5 mm in size was finely cut and stored at -20°C in RNAlater (Thermo Scientific, US). We mechanically disrupted the tissue from RNAlater using a MediMachine (BD Biosciences ...
-
bioRxiv - Biochemistry 2024Quote: ... the RNA was subjected to 5’ adapter ligation with a 5’ chimeric DNA-RNA adapter (5’aminolinker-GTTCAGAGTTCTACAGTCCGACGATCrNrNrNrN) using RNA ligase (EL0021, Thermo Fisher Scientific) at 37°C for 1 hour ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5’TYE563-labeled locked nucleic acid probes (Exiqon) against mouse major satellite sequences (Supplementary Table 5) were precipitated with mouse Cot-1 DNA (Invitrogen) and Salmon Sperm DNA (Thermo Fisher Scientific) ...
-
bioRxiv - Molecular Biology 2021Quote: ... We labeled the purified RLC with 10 molar excess of 5-((((2-Iodoacetyl)amino)ethyl)amino)naphthalene-1-sulfonic acid (IAEDANS, Invitrogen) or dabcyl C2 maleimide (AnaSpec ...
-
bioRxiv - Immunology 2022Quote: ... and under a 12-hour day/night photoperiod schedule (Percival Scientific, IA, USA) with 5% dextrose (w/v) and 0.05% para-Aminobenzoic acid (w/v) (Thermo Fisher). Mosquito oocysts were checked at 10-days post-infection ...
-
bioRxiv - Neuroscience 2020Quote: ... MEF were grown as monolayers at 37°C with 5% CO2 in DMEM supplemented with 10% serum and MEM non-essential amino acids (Gibco), or with 5% delipidated fetal bovine serum and 35 μM oleic acid ...
-
bioRxiv - Biochemistry 2022Quote: ... the gel was rinsed in Milli-Q water for 5 minutes and stained for 20 minutes with 1x SYBR gold nucleic acid stain (Invitrogen) in 1x TBE ...
-
bioRxiv - Genetics 2022Quote: ... as well as fibroblasts and SH-SY5Y cells treated for 5 hours with 100 µM oleic acid (OA) following over-night starvation in Opti-MEM (ThermoFisher). OA is a potent inducer of lipid droplet formation (55) ...
-
bioRxiv - Bioengineering 2023Quote: ... The concentrated virus was diluted 1:5 in hepatocyte medium containing N-2-hydroxyethylpiperazine-N-2-ethane sulfonic acid buffer (HEPES; 20 mM; Gibco) and 4 μm/mL polybrene (Sigma ...
-
MET functions in tumour progression and therapy resistance are repressed by intronic polyadenylationbioRxiv - Molecular Biology 2023Quote: Total RNAs of patients were extracted from either FFPE (Formalin-fixed paraffin-embedded) or frozen sections (5 x 20µ) using RecoverAll Total Nucleic Acid Isolation (Ambion) or Trizol (Ambion ...
-
bioRxiv - Developmental Biology 2023Quote: ... An internal standard was prepared from the isotope-labeled standards in 3% acetonitrile with 0.1% formic acid with 5 fmol/µL of Peptide Retention Time Calibration (PRTC) mixture (ThermoFisher Scientific) and 10 µg/mL E ...
-
bioRxiv - Molecular Biology 2023Quote: ... Peptides were resuspended in 2% acetonitrile in 0.1% formic acid and loaded at 5 μL/minute onto a PepMap C18 trap column (Thermo Scientific; 5 μm 100 Å particle size ...
-
bioRxiv - Biochemistry 2024Quote: ... was labeled with the fluorescent probe 5-((((2-iodoacetyl)amino)ethyl)amino)naphthalene-1-sulfonic acid (1,5-IAEDANS from Molecular Probes) as previously described (17 ...
-
bioRxiv - Genetics 2021Quote: Human TERT cDNA39 was cloned into the gateway pDONR221 plasmid (Invitrogen). TERT variants were generated using the Q5 Site-Directed Mutagenesis Kit (NEB ...
-
bioRxiv - Genomics 2020Quote: ... 20x human TERT TaqMan™ Copy Number Reference Assay (ThermoFisher 4403316) as internal reference control ...
-
bioRxiv - Cancer Biology 2021Quote: ... and the reference assays for TERT (Thermo Fisher Scientific cat # 4403316) and RNase P (Thermo Fisher Scientific cat # 4403326 ...
-
bioRxiv - Biochemistry 2023Quote: ... methyl tert-butyl ether and 2-propanol were from Thermo Fisher Scientific (Pittsburg ...
-
bioRxiv - Immunology 2024Quote: ... N/TERTs were grown in Keratinocyte-SFM medium (ThermoFisher #17005-042) supplemented with 30 μg/ml bovine pituitary extract ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies) ...
-
bioRxiv - Plant Biology 2023Quote: ... using primers GtEFF1 (5’-CCCTGCAAGCTCTTCCTCTTAG-3’) and GtEFR1 (5’-GCATGCGAGGTCCCAAAA-3’) with the TaqMan probe (5’-6FAM-ACTGCACAGACCATC-MGB-3’) (Thermo Scientific™, USA) (Keenan et al. ...
-
bioRxiv - Molecular Biology 2021Quote: ... Incubation in prehybridization buffer (5× sodium saline citrate buffer [SSC], 5× Denhardt’s solution [ThermoFisher Scientific] ...
-
bioRxiv - Biophysics 2019Quote: ... 5 μL of 5 mg/mL streptavidin-labeled with Alexa Fluor 488 (ThermoFisher Sci.) was added for 30 minutes ...
-
bioRxiv - Cell Biology 2021Quote: ... sense 5’-CAAAGGACAACUGUCAGACACAGAA-3’ and antisense 5’-UUCUGUGUCUGACAGUUGUCCUUUG-3’) were purchased from Thermo Fisher Scientific ...
-
bioRxiv - Biophysics 2021Quote: Oligonucleotides ssDNASel25 (5’GGACAGGAAUUAAUAGUAGCUGUCC3’) and FITC(5’)-ssDNASel25 oligonucleotides were obtained from Invitrogen (USA), Cy5-DNA (5’ Cy5-AAACTATTATTACTCATTTTCCGCCAGCAGTCAACTTCGATTTAATTCGTAAACAGATCT3’ ...
-
bioRxiv - Bioengineering 2022Quote: ... 5% CO2 and 5% O2 in Essential 8 medium (Thermo Fisher Scientific, Waltham, MA) on Matrigel- (BioStrategy ...
-
bioRxiv - Biochemistry 2022Quote: 5 μM purified PWWP domain was incubated with 5× SYPRO Orange (Thermo Fisher Scientific) in assay buffer (20 mM Tris-HCl ...
-
bioRxiv - Bioengineering 2022Quote: ... stained with 5 μM DRAQ5 (Thermo Scientific, nuclear dye, 5 minutes at 37°C), fixed in 4% paraformaldehyde for 20 minutes ...
-
bioRxiv - Biochemistry 2022Quote: 5 μg of purified protein was mixed with 5× SYPRO orange (Thermo Fisher Scientific) in 20 mM Tris-HCl pH 8.0 ...
-
bioRxiv - Immunology 2021Quote: ... and 5’ Rapid amplification of complementary DNA (cDNA) ends (5’RACE, Invitrogen, 18374-058) method as described previously20,21 ...
-
bioRxiv - Immunology 2021Quote: ... 5 ng/mL IL-1β and 5 ng/mL IL-23 from Invitrogen (14823163) (Th17.1s ...
-
bioRxiv - Cell Biology 2023Quote: ... equipped with a PEPMAP100 C18 5 µm 0.3 × 5 mm trap (Thermo Fisher Scientific) and an HSS-T3 C18 1.8 μm ...
-
bioRxiv - Cell Biology 2023Quote: ... sense 5’-CUACAAAGCUGAUGAAGAC-3’ and antisense 5’-GUCUUCAUCAGCUUUGUAG-3’) were purchased from Thermo Fisher Scientific ...
-
bioRxiv - Bioengineering 2023Quote: ... RPMI with 5% fetal bovine serum and 5 μM Lysotracker deep red (ThermoFisher Scientific) was used following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... pH 7.0) and 2 µg anti-5-methylcytosine (5-mC) antibody (Thermo Fisher, 33D3), and incubated at 4°C overnight with rotation ...
-
bioRxiv - Cell Biology 2020Quote: ... 5 μg/ml blasticidin (Invitrogen) and 200 μg/ml zeocin (Invivogen ...
-
bioRxiv - Immunology 2021Quote: ... 5% penicillin-streptomycin (PenStrep, Gibco), 1x MEM non-essential amino acids solution ...
-
bioRxiv - Cell Biology 2020Quote: ... + 5% FBS (Gibco, 16140-071) + 1% Pen-Strep (Gibco ...
-
bioRxiv - Immunology 2021Quote: ... supplemented with 5% FCS (Gibco), 25 nM β-mercaptoethanol (Sigma-Aldrich) ...
-
bioRxiv - Cancer Biology 2022Quote: ... 5 mM EDTA (ThermoFisher Scientific) at 37 °C for 20 minutes ...
-
bioRxiv - Molecular Biology 2021Quote: ... with 5 µL SuperaseIN (Invitrogen) in 100 µL total volume at 37 °C for 20 min ...
-
bioRxiv - Genomics 2020Quote: ... 5% AA (Gibco® MEM), Non-Essential Amino Acids ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5% penicillin and streptomycin (Gibco), and L-glutamine (Gibco) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5% penicillin and streptomycin (Gibco), and L-glutamine (Gibco) ...
-
bioRxiv - Bioengineering 2019Quote: ... 5 µg/ml fibronectin (Invitrogen) was added during overnight ligand incubation to promote cardiomyocyte attachment to the tissue culture surfaces.
-
bioRxiv - Neuroscience 2019Quote: ... containing DRAQ-5 (Thermo Fisher, 62251 ...
-
bioRxiv - Neuroscience 2019Quote: ... and 5% goat serum (Gibco)) ...
-
bioRxiv - Neuroscience 2019Quote: ... and 5% goat serum (Gibco)) ...
-
bioRxiv - Cancer Biology 2019Quote: 5 μM MitoSOX Red (Invitrogen) was added to cells in HBSS for 30 min followed by washing ...