Labshake search
Citations for Thermo Fisher :
301 - 350 of 10000+ citations for 5 Isobutyl thiophene 2 carbaldehyde since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
Activation of innate immune cGAS-STING pathway contributes to Alzheimer’s pathogenesis in 5×FAD micebioRxiv - Neuroscience 2022Quote: ... Slides were counterstained with 5 μg/mL 4’,6-diamidino-2-phenylindole (DAPI; ThermoFisher Scientific) for 10 min at room temperature and washed with 1 × PBST (0.2% Triton-X 100 ...
-
bioRxiv - Neuroscience 2022Quote: ... Animals were injected intraperitoneally with 40 mg/kg EdU (5- ethynyl-2’-deoxyuridine; Invitrogen, E10187) before and after the session ...
-
bioRxiv - Neuroscience 2022Quote: Mice were injected with 100 mg/kg of 5-ethynyl-2’-deoxyuridine (EdU; Invitrogen #E10187) by intraperitoneal injection for 5 consecutive days ...
-
bioRxiv - Cell Biology 2023Quote: ... Reduction of proteins was achieved with 5 mM Tris(2-carboxyethyl)phosphine hydrochloride (Thermo Fisher) for 30 min and samples were subsequently alkylated in 10 mM iodoacetamide (Sigma Aldrich ...
-
bioRxiv - Microbiology 2023Quote: ... Nuclei were counterstained by Hoechst 33342 (Thermo Fisher Scientific, 2 μg/mL, 5 min, RT), and slides were mounted in ProLong Gold antifade mountant (Thermo Fisher Scientific) ...
-
bioRxiv - Biochemistry 2023Quote: ... 2 μM purified DNMT3A2 was incubated in triplicate with 5× SYPRO Orange (Thermo Fisher Scientific) in assay buffer (50 mM Tris-HCl ...
-
bioRxiv - Cancer Biology 2023Quote: ... Recovered nuclei were stained with FITC-conujugated α-5-bromo-2’-deoxyurine (Invitrogen, MoBu-1) in staining buffer (2 mM HEPES pH 7.4 ...
-
bioRxiv - Neuroscience 2023Quote: ... 5-ethynyl-2’-deoxyuridine (EdU, 12.5 mg/kg, Thermo Fisher Scientific Inc. Waltham, MA, USA) was intraperitoneally injected into pregnant C57BL/6 mice once a day (12 P.M. ...
-
bioRxiv - Developmental Biology 2023Quote: Tadpoles were immersed in a solution containing 1 mM EdU (5-ethynyl-2’-deoxyuridine; Invitrogen) before fixation ...
-
bioRxiv - Cell Biology 2023Quote: ... the germinated seeds were incubated in 50 μM 5-ethynyl-2′-deoxyuridine (EdU; Invitrogen, USA) for 15 min (CLEM ...
-
bioRxiv - Microbiology 2023Quote: ... and 2-5 μl sample were loaded onto 10-20% SDS-tricine gels (Invitrogen, #EC66252BOX) and LPS was silver stained as described previously [47] ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5 µL of DNase TURBO 10X Buffer and 2 µL of DNase TURBO (Invitrogen, #AM2238) were then added and the reactions are incubated at 37 °C for 30 minutes ...
-
bioRxiv - Biochemistry 2023Quote: ... 5 mM Hepes-K+ pH 7.6) containing 2 mg/mL of collagenase type II (GIBCO) for 1 h at room temperature ...
-
bioRxiv - Biochemistry 2023Quote: ... Glycoproteins were reduced with 5 mM tris(2-carboxyethyl)phosphine hydrochloride (TCEP-HCl; Thermo Scientific) and alkylated with 10 mM 2-Chloroacetamide (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2024Quote: ... Mouse IgG1 anti-alpha Tubulin Clone B-5-1-2 (1:500, ThermoFisher 32-2500), Rabbit anti-Myc polyclonal (1:500 ...
-
bioRxiv - Biochemistry 2024Quote: ... Acclaim PepMap 100 nanoViper C18 (Thermo Scientific, 100 μm×2 cm, 5 μm, 100 Å) was used as a trap column ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were incubated with a mix of 5 µM Fura-2 AM (Invitrogen™, F1221) and 0.025% Pluronic® F-127 (diluted in CM ...
-
bioRxiv - Neuroscience 2022Quote: ... with 16 μM BSA in the presence of CaCl2 (1.3mM) and fura-2-acetoxymethyl ester (fura 2-AM, 5 μM: Molecular Probes, Eugene, OR, USA), and they were incubated at 37 °C for 25 min ...
-
bioRxiv - Physiology 2021Quote: ... HUVECs were washed 2 × with D-PBS and loaded with DAF-FM™ diacetate (4-amino-5-methylamino-2′,7′-difluorofluorescein diacetate; Molecular Probes, Invitrogen) to a final concentration of 1 µM in KRH buffer and incubated at 37°C for 45 minutes protected from light ...
-
bioRxiv - Neuroscience 2023Quote: ... The cells were loaded with 5 μM acetoxymethyl-ester of Fura-2 (Fura-2/AM) and 80 μg /ml pluronic F127 (Molecular Probes, Eugene, Oregon) for at least 30 minutes at room temperature ...
-
bioRxiv - Plant Biology 2022Quote: ... Each sample was incubated with 50 µm of 2’,7’-Bis-(2- carboxyethyl)-5-(6)-carboxyfluorescein acetoxymethyl ester (BCECF-AM; Molecular Probes, Eugene, OR) at 28°C ...
-
bioRxiv - Biochemistry 2021Quote: ... The 5 mL HisTrap column was washed with 10 column volumes of wash buffer (2× GIBCO 14200-075 PBS, 5 mM Imidazole, pH 7.5) followed by 6 column volumes of elution buffer (2× GIBCO 14200-075 PBS ...
-
bioRxiv - Biochemistry 2019Quote: ... 300 μm × 5 mm, 5 μm, 100 Å, separation column: C18, Acclaim PepMap, 75 μm × 500 mm, 2 μm, 100 Å, Thermo Fisher Scientific). After loading the sample on the precolumn ...
-
bioRxiv - Molecular Biology 2020Quote: ... The tryptic peptides were loaded at 5 μL/min onto a C18 trap column (Thermo Scientific, 100 µm ID×2 cm, 5 μm, 120 Å). Peptides were separated with PicoFrit columns (New Objective ...
-
bioRxiv - Molecular Biology 2022Quote: A concentration of 6 × 103 cells was loaded with 5 mM 4-amino-5-methylamino-2’,7’- difluorofluorescein diacetate (DAF-FM, Molecular Probes, Thermo Fisher, Sao Paulo, Brazil) after 72 h of treatment ...
-
bioRxiv - Systems Biology 2020Quote: ... Disulfide bonds were reduced with 5 mM Tris(2-carboxyethyl)phosphine (TCEP) Bond-breaker (Thermo Scientific) at RT for 1 hr ...
-
bioRxiv - Cell Biology 2020Quote: ... protected by an Acclaim PepMap C18 column (100 μm x 2 cm, 5 μm; Thermo Scientific) before injection into a Q-Exactive mass spectrometer (ThermoFisher) ...
-
bioRxiv - Microbiology 2020Quote: ... The precolumn was a 2 cm EASYcolumn (ID 100 µm, 5 µm particles) (Thermo Fisher Scientific) while the analytical column was a 10 cm EASY-column (ID 75 µm ...
-
bioRxiv - Developmental Biology 2021Quote: ... The eggs were then loaded with the calcium indicator Fura-2 AM (5 μM; Thermo Fisher) for 30 min in KSOM containing 0.02% pluronic F-127 (Thermo Fisher) ...
-
bioRxiv - Neuroscience 2020Quote: ... the drinking water contained thymidine analogue EdU (5-ethynyl-2’-deoxyuridine, Thermo Fisher, cat. no: E10415) to label newly-generated cells ...
-
Control of cortical cytoskeleton-membrane interaction by RhoA regulates peripheral nerve myelinationbioRxiv - Neuroscience 2021Quote: ... the Click-iT EdU (5-ethynyl-2’-deoxyuridine) Alexa Fluor (AF) 568 imaging kit (Molecular Probes) was used in accordance with the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... 20 μl RNase A/T1 mix (2 μg μl−1 / 5 U μl−1, Thermo Scientific) was added to 100 μl lysate (OD260 ~ 150 ...
-
bioRxiv - Microbiology 2019Quote: ... HEp-2 cells were initially seeded in growth medium (DMEM medium with 5% FBS (ThermoFisher, USA), 1% Penicillin/Streptomycin (ThermoFisher ...
-
bioRxiv - Biochemistry 2019Quote: ... 4-amino-5-methylamino-2’,7’-difluorofluorescein diacetate (DAF-FM DA; Molecular Probes, Eugene, OR, USA) was used to detect NO production in sorghum genotype stalks in response to inoculation treatment at 7 DPI ...
-
bioRxiv - Neuroscience 2020Quote: ... injection of EdU (5-ethynyl-2’-deoxyuridine; Click-it EdU Alexa Fluor 488 imaging kit, Invitrogen) at 5 and 6 days DPD at 50 mg/kg ...
-
bioRxiv - Neuroscience 2020Quote: ... The water contained 1 mg/mL 5-ethynyl-2-deoxyuridine (EdU) (Thermo Fisher Scientific, Cat. # E10187) and 1% sucrose ...
-
bioRxiv - Immunology 2020Quote: ... washed 2 × 100μL with complete RPMI and stained with 5 nM TMRE (T669, Thermo Fisher Scientific) in 200 μL complete RPMI at RT for 20 min ...
-
bioRxiv - Physiology 2021Quote: ... 1-2 µg of vector DNA was mixed with 5 µl of Lipofectamine™ (Thermo Fisher) in OPTIMEM-I media (GIBCO ...
-
bioRxiv - Molecular Biology 2020Quote: ... Primer extension was performed with 2 pmol of DNA gene-specific primers (5’CATGCTTAACGTAATTCAACAGAAATTATATG) by Invitrogen SuperScript III reverse transcriptase ...
-
bioRxiv - Microbiology 2021Quote: ... RT-qPCR detection of SARS-CoV-2 was performed on a QuantStudio 5 instrument (Applied Biosystems) using a TaqPath 1-step RT-qPCR Master Mix (Applied Biosystems ...
-
bioRxiv - Microbiology 2019Quote: TbPolN RNAi cells were incubated with 150 µM of 5-ethynil-2’-deoxyuridine (EdU; Life Technologies) for 4 hrs at 37 °C with 5% CO2 ...
-
bioRxiv - Molecular Biology 2019Quote: ... 5×107 mESCs were resuspended in PBS and crosslinked in 2 mM disuccinimidyl glutarate (Thermo Scientific) for 45 min at 25°C with gentle rotation ...
-
bioRxiv - Cancer Biology 2019Quote: Cells were labelled with 10 μM 5-bromo-2′-deoxyuridine (BrdU) (Thermo Fisher Scientific, Cat. #: B23151) for 30 min ...
-
bioRxiv - Zoology 2020Quote: ... After 2 h and 30 min we added 5 μM dihydrorhodamine-123 (DHR) (Thermo Fisher Scientific) to the cell suspension to stain cells positive for reactive oxygen species (ROS ...
-
bioRxiv - Genomics 2021Quote: ... followed by 2 x 5 min washes in PBS before mounting in Prolong Diamond (Life Technologies).
-
bioRxiv - Immunology 2020Quote: T cells (5×106) from triplicates of 2 independent experiments were lysed in TRIzol reagent (ThermoFisher). Total RNA was isolated per manufacturer’s instruction and resuspended in RNase free water ...
-
bioRxiv - Immunology 2020Quote: Mice were injected intraperitoneally with 0.5 mg 5-ethynyl-2’-deoxyuridine (EdU, Invitrogen or Sigma-Aldrich). For pulse experiments ...
-
bioRxiv - Cell Biology 2022Quote: 200,000 cardiomyocytes were incubated in Amplex Red (5 μM; 2 min) for cellular ROS (A22177, ThermoFisher), or MitoSOX Red (5 μM ...
-
bioRxiv - Immunology 2022Quote: ... 2-5×106 cells were incubated in 15 μl Indo-1 solution in 1ml IMDM (Gibco) + 1%FBS (Sigma ...
-
bioRxiv - Bioengineering 2022Quote: ... RBC (5 million cells/mL) were incubated with 2 μg/mL calcein AM (Thermo Fisher Scientific) for 15 minutes at 37°C ...