Labshake search
Citations for Thermo Fisher :
101 - 150 of 10000+ citations for 5 Isobutyl thiophene 2 carbaldehyde since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2022Quote: ... discoideum clones on SM/5 plates (2 g glucose (Fisher Scientific), 2 g Bacto Peptone (Oxoid) ...
-
bioRxiv - Genomics 2019Quote: ... 2 µL T4 DNA ligase (5 Weiss U/µL, Thermo Scientific) was added followed by incubation for 1 h at room temperature ...
-
bioRxiv - Immunology 2019Quote: ... supplemented with 5 ng/mL recombinant human interleukin 2 (Gibco, #PHC0027), 2 mM L-glutamine (Lonza ...
-
bioRxiv - Neuroscience 2020Quote: ... 5-ethynyl-2’-deoxyuridine (EdU) (Click-iT Plus EdU Kit, Invitrogen) and 5-bromo-2’-deoxyuridine (BrdU ...
-
bioRxiv - Cell Biology 2019Quote: ... 5 µl of 2× concentrated PowerSYBR Green PCR MasterMix (Thermo Fisher), 2 pmoles of each primer and water up to 10 µl ...
-
bioRxiv - Cell Biology 2020Quote: ... Twenty min before fixation EdU (5-ethynyl-2’-deoxyuridine, Molecular probes) was added in all the experiments ...
-
bioRxiv - Cancer Biology 2020Quote: ... 2×10^5 cells were lysed in RIPA buffer (Thermo Fisher) with protease and phosphatase inhibitors (Thermo Fisher) ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells were incubated with EdU (5-ethynyl-2’-deoxyuridine, Life technologies) at final concentration of 10 µM for 4 hours and then harvest to perform Click-iT reaction using Click-iT EdU flow cytometry Alexa Fluor 488 assay kit (Life technologies ...
-
bioRxiv - Genomics 2022Quote: ... supplemented with 5 mM MgCl2 and 2% penicillin–streptavidin (Gibco, #15140122). Minced tissue was digested with enzyme solution at 37°C for 60-90 min with gentle shaking ...
-
bioRxiv - Cell Biology 2022Quote: ... 50 µM 5-ethynyl-2′-deoxyuridine (EdU) (Invitrogen, Carlsbad, CA, USA); 10 µM 5-bromo-2’-deoxyuridine (BrdU ...
-
bioRxiv - Neuroscience 2020Quote: ... or 4′,6-diamidino-2-phenylindole (DAPI, 5 μg/ml, Invitrogen) were included in the secondary antibody solution to stain nuclei.
-
bioRxiv - Genomics 2022Quote: ... supplemented with 5 mM MgCl2 and 2% penicillin–streptavidin (Gibco, #15140122). Tissue was incubated with enzyme solution for 30 min at 37°C with gentle shaking ...
-
bioRxiv - Neuroscience 2021Quote: ... pH 7.4) supplemented with 5 μM Fura-2 AM (Thermo Fisher), 50 μM pluronic acid F-127 (Thermo Fisher ...
-
bioRxiv - Neuroscience 2023Quote: ... 2% B-27 supplement and 5% fetal bovine serum (Invitrogen, Canada) plus 1/3 of minimum essential medium enriched with 1% penicillin/streptomycin ...
-
bioRxiv - Cancer Biology 2023Quote: ... 40 µM 5-ethynyl-2’-deoxyuridine (EdU, Invitrogen, Waltham, MA, USA) was added to the cells ...
-
bioRxiv - Physiology 2023Quote: After loading with Fura-2 AM (5 μM, Invitrogen, F-1201), isolated sweat glands on coverslips were mounted in an open chamber and rinsed with standard bath solution containing (in mM) ...
-
bioRxiv - Neuroscience 2023Quote: ... or 4°,6-diamidino-2-phenylindole (DAPI, 5 μg/ml, Invitrogen) were added during the first wash step to visualize nuclei ...
-
bioRxiv - Immunology 2023Quote: ... 5-ethynyl-2’-deoxyuridine (EdU) (1 mg, Thermofisher, cat no: A10044) was injected intraperitoneally and mice were sacrificed after 2.5 h ...
-
bioRxiv - Immunology 2023Quote: Caco-2 cells were incubated with 5 µM MitoSOX™ (Invitrogen) in serum free growth medium for 20 min at 37°C per manufacture protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were incubated in 5-ethynyl-2’-deoxyuridine (EdU; ThermoFisher A10044) dissolved in K-SFM (20 mM final concentration ...
-
bioRxiv - Cell Biology 2023Quote: ... mice received 50mg/kg 5-ethynyl-2’-deoxyuridine (EdU, Thermo Fisher) in PBS by intraperitoneal injection 24 hr before harvest ...
-
bioRxiv - Plant Biology 2024Quote: For combined 5-ethynyl-2-deoxyuridine (Invitrogen A10044, Thermo Fisher Scientific) and modified pseudo-Schiff-propidium iodide (PI ...
-
bioRxiv - Plant Biology 2024Quote: For combined 5-ethynyl-2-deoxyuridine (Invitrogen A10044, Thermo Fisher Scientific) and modified pseudo-Schiff-propidium iodide (PI ...
-
bioRxiv - Plant Biology 2024Quote: ... respectively were stained with EdU (5-ethynyl-2′-deoxyuridine; Thermo Fisher) and modified pseudo-Schiff propidium iodide (PI ...
-
bioRxiv - Cell Biology 2024Quote: ... siRNAs targeting DHHC 2 and 5 were obtained from Thermo Fisher Scientific (Waltham ...
-
bioRxiv - Cell Biology 2020Quote: ... The following siRNAs were used: ErbB3#1 siRNA (5’CAAUACCAGACACUGUACAAGCUCU53’) and ErbB3#2 siRNA (5’UCGUCAUGUUGAACUAUAA3’) from Invitrogen) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 μM of oligonucleotide labeled with 6-carboxyfluorescein (6-FAM) at the 5’ end (5’– AACGACGGCCAGTGAATCCGTAATCATGGT–3’, Invitrogen), 50 μM each dNTP ...
-
bioRxiv - Neuroscience 2019Quote: ... Cells were passaged 1:2-1:6 every 2-5 days by being rinsed once with DPBS (Gibco) and dissociated using 0.5 mM EDTA (75 μl/cm2 ...
-
bioRxiv - Microbiology 2024Quote: ... Propidium iodide (PI) and the pH sensitive 2’,7’-Bis-(2-Carboxyethyl)-5-(and-6)-Carboxyfluorescein (BCECF) (Invitrogen) were added to these at a final concentration of 100µM and 10µM respectively ...
-
bioRxiv - Biophysics 2021Quote: ... 5 % CO2 incubator for 5 hours before replacing the culture media with 2 mL B-DMEM (Thermofisher, cat. # 10566016) supplemented with 10 % FBS (Sigma-Aldrich ...
-
bioRxiv - Bioengineering 2021Quote: ... Samples were rinsed 2 times for 5 minutes with PBS++ and incubated with 5 drops of NucBlue (Life Technologies) for 10 minutes ...
-
bioRxiv - Neuroscience 2023Quote: ... A single bolus of 50μL 0.5% Texas-red dextran solution (70,000 MW, 5 mg/mL in 0.9% NaCl, t1/2 ∼ 25min, Termo Fisher Scientific) was injected ...
-
bioRxiv - Neuroscience 2023Quote: ... A 50μl bolus of 0.5% Texas-red dextran solution (70,000 MW, 5 mg/mL in 0.9% NaCl, t1/2 ∼ 25min, Termo Fisher Scientific) was injected at a constant rate of 30μl/sec using a syringe infusing pump (GenieTouch ...
-
bioRxiv - Cell Biology 2023Quote: ... for 2–5 h at 37°C followed by a 5 min incubation in TrypLE express (Thermo Fisher Scientific) to generate small clumps of corneal endothelial cells ...
-
bioRxiv - Cancer Biology 2021Quote: ... resuspended in 2% FBS in HBSS containing 5 g/ml DAPI (Invitrogen), and sorted into DMEM containing 10% FBS ...
-
bioRxiv - Cell Biology 2019Quote: ... Cells were incubated with 1 µM 5-ethynyl-2’-deoxyuridine (EdU, Invitrogen) for 6 h (42-48 h post stimulation ...
-
bioRxiv - Genomics 2020Quote: ... 2 µl 5 M NaCl and 1 µl GlycoBlue co-precipitant (Invitrogen). Samples were vortexed and incubated at room temperature for 15 min ...
-
bioRxiv - Microbiology 2021Quote: ... 2% hematocrit in 1640 RPMI-HEPES supplemented with 5% AlbuMAX II (GIBCO) and 0.25% gentamycin complemented with appropriate Artemisia infusion dilutions and with or with IPP and Cm ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 4’,6-diamidino-2-phenylindole at 5 µg/mL (DAPI; ThermoFisher) in TBS 1% BSA ...
-
bioRxiv - Developmental Biology 2020Quote: ... containing 4’,6-diamidino-2-phenylindole (DAPI, 5 µg/ml, Life Technologies).
-
bioRxiv - Cell Biology 2022Quote: ... 2.5 mg of 5-ethynyl-2’ deoxyuridine (EdU) (Thermo Fisher Scientific, A10044) was injected intraperitoneally 12 h prior to euthanasia ...
-
bioRxiv - Molecular Biology 2022Quote: ... 5 μl of 2 x Novex TBE-Urea Sample Buffer (ThermoFisher Scientific) was added ...
-
bioRxiv - Molecular Biology 2020Quote: ... for 4h and EdU (5-ethynyl-2’-deoxyuridine from Invitrogen; 10µM final) was added 1h before cells were harvested ...
-
bioRxiv - Immunology 2020Quote: ... 50 μM 2-mercaptoethanol and 5% NCTC-109 medium (Gibco, Waltham, MA). For induction of SHM ...
-
bioRxiv - Developmental Biology 2020Quote: ... mice were injected intraperitoneally with 5-ethynyl-2’-deoxyuridine (EdU; E10187; Invitrogen) at 10 mg/kg 3 hours prior to euthanasia to assay cellular proliferation.
-
bioRxiv - Systems Biology 2019Quote: ... Plasmids (2 µg) and transfection reagent (5 µL of Lipofectamine 2000; Invitrogen) was added to 125 µL of OptiMEM serum-free media (ThermoFisher ...
-
bioRxiv - Physiology 2021Quote: ... The fibers were then loaded with 5 μM Fura-2 AM (Invitrogen) by incubating them for 20 min at 19°C in Tyrode’s buffer ...
-
bioRxiv - Immunology 2021Quote: ... 5 μg/mL of brefeldin A and 2 μM Monensin (both ThermoFisher) were added to each well ...
-
bioRxiv - Immunology 2020Quote: ... The 2× RT mastermix contained 1 μl 5× SuperScript II buffer (Thermofisher), 0.25 μl 100 mM DTT (Thermofisher) ...
-
bioRxiv - Systems Biology 2023Quote: ... cells were incubation with 10uM EdU (5-ethynyl-2’ -deoxyuridine) (Invitrogen, C10424) for 48hours together with either recombinant-mouse TIMP1 protein (1µg/ml ...