Labshake search
Citations for Thermo Fisher :
501 - 550 of 10000+ citations for 2' 3' cGAMP STING based FRET Detection Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... Recipient cells were incubated with either PKH67 dye-labelled or fluorescent-labelled sEVs for 2-3 days in media supplemented with 5% exosome-depleted FBS (Gibco, USA). Cells were imaged with time-lapse microscopy or washed with PBS ...
-
bioRxiv - Microbiology 2023Quote: ... qPCR was conducted in 384-well plates using the SensiFAST SYBR Lo-ROX Kit (Meridian Bioscience) on the QuantStudio 5 (384-well plate) qPCR cycler (Applied Biosystems, Foster City, CA, USA). The qPCR program encompassed 40 cycles ...
-
bioRxiv - Cell Biology 2020Quote: ... and Y14 siRNA (5’-GGGUAUACUCUAGUUGAAUUUCAUAUUCAACUAGAG-3’) with Lipo2000 (Invitrogen) in Optimem (Gibco) ...
-
bioRxiv - Microbiology 2021Quote: ... siDDX42-4: 5’-AUCUCGAAUACCCUUUACG-3’ (ID:136410, Ambion®).
-
bioRxiv - Cancer Biology 2020Quote: ... 5’-UGGUUUACAUGUCGACUAA-3’ KIF18A (Silencer Select s37882 – Ambion)8 5’-UCUCGAUUCUGGAACAAGCAG-3’ RAD51 (Silencer Select s11735 – Ambion) 5’-UGAUUAGUGAUUACCACUGCT-3’ RRM1 (On-Target plus SMARTpool – Dharmacon)
-
bioRxiv - Genetics 2024Quote: ... 5′-UUAAUUUACGCGGUUUUUAUU-3′) using the RNAiMAX transfection reagent (Invitrogen) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2019Quote: ... mRNAs were fragmented for 3 minutes at 70 °C using a Zinc-based alkaline fragmentation reagent (AM8740, Ambion). RNAs were cleaned up using RNeasy MinElute Cleanup Kits (74204 ...
-
bioRxiv - Genetics 2020Quote: ... 25 μL of media containing STS and CellEvent Caspase-3/7 Green Detection Reagent (ThermoFisher) at final treatment concentrations of 1 μM and 2.5 μM ...
-
bioRxiv - Immunology 2022Quote: ... Alexa Fluor 488 and caspase-3/7 activity detection dyes were purchased from Thermo Fisher, and Viobility™ 405/452 Fixable Dye from Miltenyi Biotec.
-
bioRxiv - Microbiology 2023Quote: ... Apoptosis assays were perfomed using CellEvent Caspase 3/7 Green Detection Reagent (Thermo Fisher Scientific) and Live/Dead eFluor 660 (Thermo Fisher Scientific) ...
-
bioRxiv - Synthetic Biology 2021Quote: ... cells were dissociated into single cells with TrypLETM for 4-5 minutes at 37 C and seeded into 2 % Geltrex coated 96- or 12-well plates (Fisher Scientific) in Essential 8TM Medium (Gibco ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Amoebae were grown from frozen spores at room temperature on 100 x 15mm plates filled with 30mL SM/5 agar (2 g glucose (Fisher Scientific), 2 g Bacto Peptone (Oxoid) ...
-
bioRxiv - Pathology 2024Quote: ... 2 µl drops of yeast suspension were plated in five 1:5 serial dilutions on 100 mm square plates (Thermo Fisher) with selective SD medium and increasing concentrations (0.07–7 µg/ml ...
-
bioRxiv - Microbiology 2021Quote: Immulon 2 HB 96-well plates (Thermo Fisher) were coated overnight at RT with 100μl/well 0.25μg/ ml recombinant SARS-CoV-2 Spike or Spike receptor binding domain protein (Sino biological ...
-
bioRxiv - Immunology 2022Quote: Immulon 2 HB 96-well plates (Thermo Fisher) were coated overnight at RT with 100 μl/well recombinant HA (0.5 μg/ml) ...
-
Enzymatic RNA Biotinylation for Affinity Purification and Identification of RNA-protein InteractionsbioRxiv - Biochemistry 2020Quote: ... Blot was developed for biotin detection using the Chemiluminescent Nucleic Acid Detection Module Kit (Thermo Scientific, Waltham, MA)
-
bioRxiv - Cancer Biology 2021Quote: ... Detection of the biotinylated probe was done using the Chemiluminescent Nucleic Acid Detection Module Kit (Thermo Fisher 89880).
-
Control of cortical cytoskeleton-membrane interaction by RhoA regulates peripheral nerve myelinationbioRxiv - Neuroscience 2021Quote: ... the Click-iT EdU (5-ethynyl-2’-deoxyuridine) Alexa Fluor (AF) 568 imaging kit (Molecular Probes) was used in accordance with the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: ... injection of EdU (5-ethynyl-2’-deoxyuridine; Click-it EdU Alexa Fluor 488 imaging kit, Invitrogen) at 5 and 6 days DPD at 50 mg/kg ...
-
bioRxiv - Developmental Biology 2023Quote: The medusae were incubated with 150 μM 5-ethynyl-2’-deoxyuridine (EdU) (EdU kit; Invitrogen, C10337) in ASW for 1 h or 24 h ...
-
bioRxiv - Developmental Biology 2019Quote: The compound 5-(and-6)-carboxy-2’,7’-dichlorodihydrofluorescein diacetate (carboxy-H2DCFDA, Image-iT LIVE Green Reactive Oxygen Species Detection Kit, Molecular Probes; Invitrogen, I36007) was used to visualise the in vivo production of ROS ...
-
bioRxiv - Cell Biology 2021Quote: Genome DNA was extracted from A431 cells (wild type, clones #1 and #2) using GeneArt Genomic Cleavage Detection Kit (Thermo Fisher Scientific), following the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were then washed twice with PBS and fixed with 2% PFA before being stained for β-galactosidase activity with the CellEvent™ Senescence Green Detection Kit (Invitrogen) per manufacturer instructions.
-
bioRxiv - Immunology 2020Quote: ... – 80 wells per plate and 2 plates (AK1,2-3,4)– 96 wells per plate) 21 ml of Opti-Mem (Gibco) was mixed with DNA ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were pulsed with 10µM 5-Ethynyl-2’deoxyuridine (EdU) for 2 hours following manufacturer’s instructions (Click-iT® EdU Alexa Fluor® Imaging Kit, Life Technologies). Cells were subsequently fixed and stained with Hoechst 33342 ...
-
bioRxiv - Microbiology 2022Quote: ATP concentrations were quantified with the luciferase-based ATP determination kit (Molecular Probes). Briefly ...
-
bioRxiv - Immunology 2021Quote: ... Mice were genotyped by PCR using forward primers 5’-ctgagcagagacccactgaaag-3’ and reverse primers 5’- ggatctggcttctgagtttgtgta-3’ and amplicons were ran in 6% TBE gels (Life Technologies, Carlsbad, CA).
-
bioRxiv - Cancer Biology 2019Quote: ... oligonucleotide duplexes were designed against TG2 (sense, 5’-AAGGGCGAACCACCTGAACAA-3’ and antisense, 5’-TTGTTCAGGTGGTTCGCCCTT-3’) and TOPOIIα siRNA (purchased from Thermo Fisher, Catalog # AM16708). Plasmids and miRNA were transfected with Lipofectamine 3000 (Invitrogen ...
-
bioRxiv - Biochemistry 2021Quote: ... We did this by amplification of the GlyR-FP plasmids using PCR with primers 5’-ATATGGTACCTGGGAGGTCTATATAAGCAGAG-3’ and 5’ATAAGGTACCCCAGGCGGGCCATTTACCGTA-3’ followed by digestion with KpnI (ThermoFisher Scientific, Merelbeke, Belgium) and ligation using instant sticky-end ligase Master mix (NEB ...
-
bioRxiv - Cell Biology 2020Quote: ... 16nM TIMM23 (5’ CCCUCUGUCUCCUUAUUUA 3’, Eurogentech) or 16nM TIM22 (5’ GUGAGGAGCAGAAGAUGAU 3’, Eurogentech) using the Invitrogen Lipofectamine RNAiMAX Reagent (Invitrogen, Carlsbad, CA, USA) diluted with serum-free Gibco Opti-MEM I medium (Gibco ...
-
CRISPR screens for lipid regulators reveal a role for ER-bound SNX13 in lysosomal cholesterol exportbioRxiv - Cell Biology 2021Quote: ... cells were transfected with siRNAs targeting human SNX13 (5’- CAGAAAGGCUCAACAGAAAUU-3’) or SNX14 (5’-GGAUGAAAGUAUUGACAAAUU-3’) using Lipofectamine RNAiMax (Invitrogen, Cat#13778-075) according to the manufacturer ...
-
bioRxiv - Microbiology 2020Quote: ... Approximately 3 kb RT-PCR products covering the S gene deletion were amplified from the viral RNA using the gene specific primers F9newF and F9newR (5’-TAAGGTTGGTGGTAATTATAATTACCTG-3’ and 5’-AAAATAGTTGGCATCATAAAGTAATGGG-3’) and a SuperScript™ IV One-Step RT-PCR System (Invitrogen™, ThemoFisher). A region spanning the deletion was sequenced using primers Wu_24_L and Wu_24_R (5’-TTGAACTTCTACATGCACCAGC-3’ and 5’-CCAGAAGTGATTGTACCCGC-3’).
-
bioRxiv - Evolutionary Biology 2021Quote: ... amplified with a set of forward (5’-GAGGGTGAGCTCTCCGAAGGTTGTAG-3’) and reverse (5’-AATTATGAGCTCTGGGAG-TGCGCAAG-3’) primers using DreamTaq DNA Polymerase (Thermo Fisher Scientific, USA). The isolated genomic DNAs were also subjected to amplify full length betasatellites using forward (5’-AGTAAGGGTACCACTACGCTACGCAG-3’ ...
-
bioRxiv - Immunology 2020Quote: ... qPCR for parasite burden was conducted using toxoplasma specific primers: (forward) 5’-TCCCCTCTGCTGGCGAAAAGT-3’ and (reverse) 5’-AGCGTTCGTGGTCAACTATCGATT G-3’ and Power SYBR Green master mix (Applied Biosystems, CA, USA). The qPCR condition settings were ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5’ACCATCGCGATAATACGACTCACTATAGGG ACCTCTCTATGGGCA GTCTCCTCTCTATGGCAGTCGACAAA 3’) and RG-5UTR-new-R (5’TCACCGGATAACGGGTTCAATAGAGTTAATTTAATAACTCTATTTGTCGACTGCC ATAGAGAGGAGACTG 3’) and Pfu polymerase (Thermo Fisher Scientific, Waltham, MA, USA). The PCR product was extracted from the gel ...
-
bioRxiv - Biophysics 2021Quote: ... Detection of relative luciferase units was carried out using a Varioskan Lux plate reader (ThermoFisher). Percent neutralization was calculated relative to signals obtained in the presence of virus alone for each experiment ...
-
bioRxiv - Bioengineering 2021Quote: Both Nefmut/SARS-CoV-2-based fusion proteins were cloned into the pVAX1 plasmid (Thermo Fisher) as already described (22) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Nuclei were identified based on 4′,6-diamidino-2-phenylindole (DAPI; purchased from Thermo Fisher Scientific) staining before measurement of nuclear γH2AX and 53BP1 staining ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: Cells were seeded in 6-well plates (5×105/well) were transfected with the indicated siRNA (3 μg) using Lipofectamine® 2000 transfection reagent (Life Technologies, 11668-019) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: ... 5-Ethynly-2’-deoxyuridine (EdU; E10415, Thermofisher) was administered to mice via their drinking water at a concentration of 0.2 mg/ml for up to 21 consecutive days (as per 58) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5-ethynyl-2′-deoxyuridine (EdU, Life Technologies) was administered intraperitoneally (500 µg per animal ...
-
bioRxiv - Neuroscience 2020Quote: ... and 2-hydroxy-5-nitrobenzaldehyde (Acros Organics, #416180050 dissolved in ethanol to 120 mM and centrifuged for one minute at 15,000 rpm to remove insoluble material ...
-
bioRxiv - Neuroscience 2020Quote: ... with 5% 2-mercaptoethanol (Thermo Fisher Scientific) was added 3:1 to an aliquot of each sample ...
-
bioRxiv - Developmental Biology 2022Quote: EdU (5-ethynyl-2’-deoxyuridine) powder (Invitrogen) was dissolved in sterile PBS into a working concentration of 2.5 mg/ml ...
-
bioRxiv - Cancer Biology 2019Quote: ... 5-ethynyl-2’-deoxyuridine (EdU) (Life Technologies) was added to a final concentration of 10 µM and incubated for 90 min at 37°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5-ethynyl-2’deoxyuridine (EdU) (Life Technologies) at stated times at a concentration of 10 μM ...
-
bioRxiv - Developmental Biology 2019Quote: 5-ethynyl-2’-deoxyuridine (EdU – ThermoFisher Scientific) retention experiments were conducted to label the nuclei of cell that have undergone S-phase DNA synthesis and their progeny (Salic and Mitchison ...
-
bioRxiv - Cell Biology 2020Quote: 5-ethynyl-2’-deoxyuridine (EdU) (Invitrogen, C10418) was dissolved with 2 ml sterile PBS at the concentration of 5 mg/ml (20 mM) ...
-
bioRxiv - Cancer Biology 2022Quote: ... 5-ethynyl-2’-deoxyuridine (EdU) (Life Technologies) was injected intraperitoneally (0.3 mg/10 g of mouse weight ...
-
bioRxiv - Biophysics 2023Quote: ... polystyrene microspheres (rbead=2·5 μm; Thermofisher) were used to template the glass discs in a continuous gold film ...