Labshake search
Citations for Thermo Fisher :
4701 - 4750 of 10000+ citations for Hemoglobin High Sensitivity Colorimetric Detection Kit 10 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2020Quote: We cultured C2C12 mouse muscle myoblasts (ATCC CRL-1772) in high glucose DMEM (ATCC 30-2002) and 10% FBS (Gibco 16000044) with 1% Penicillin-Streptomycin (Gibco ...
-
bioRxiv - Microbiology 2022Quote: ... pH 10) prior to fractionation by high pH reversed-phase chromatography using an Ultimate 3000 liquid chromatography system (Thermo Fisher Scientific). In brief ...
-
bioRxiv - Cell Biology 2020Quote: ... pH 10) prior to fractionation by high pH reversed-phase chromatography using an Ultimate 3000 liquid chromatography system (Thermo Fisher Scientific). In brief ...
-
bioRxiv - Neuroscience 2020Quote: ... pH 10) prior to fractionation by high pH reversed-phase (RP) chromatography using an Ultimate 3000 liquid chromatography system (Thermo Scientific). In brief ...
-
bioRxiv - Neuroscience 2022Quote: ... pH 10) prior to fractionation by high pH reversed-phase chromatography using an Ultimate 3000 liquid chromatography system (Thermo Fisher Scientific). In brief ...
-
bioRxiv - Molecular Biology 2020Quote: HEK293T cells were grown in 5% CO2 at 37°C and in the high glucose DMEM medium supplemented with 10% fetal bovine serum and the PenStrep antibiotics (all ThermoFisher Scientific). To stabilize beta-catenin and to induce canonical Wnt signaling the cells were treated with 1 μM BIO (6-Bromoindirubin-3′-oxime ...
-
bioRxiv - Microbiology 2019Quote: ... pH 10) prior to fractionation by high pH reversed-phase chromatography using an Ultimate 3000 liquid chromatography system (Thermo Fisher Scientific). In brief ...
-
bioRxiv - Biophysics 2019Quote: ... The cells were cultured in a complete growth medium (Dulbecco’s modified eagle medium with high glucose, Nacalai Tesque) with 10% fetal bovine serum (Thermofisher Scientific, Inc.), L-glutamine (Wako ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... were cultured in Dulbecco’s Modified Eagle Medium (DMEM, High Glucose, GlutaMAX™, Pyruvate) supplemented with antibiotics and 10% FCS (Gibco, Life technologies) and maintained in T75 Flasks at 1×106 cells per flask ...
-
bioRxiv - Cell Biology 2021Quote: ... Subhojit Roy) were cultured in HEK293T media (DMEM, high glucose, pyruvate, no glutamine; Thermo 10313021) supplemented with 10% FBS (Invitrogen 16000044) and Penicillin-Streptomycin (Invitrogen 15140122 ...
-
bioRxiv - Cancer Biology 2021Quote: Murine colon carcinoma CT26.wt cell line was purchased from ATCC and was cultured in high glucose RPMI with 10% foetal calf serum (FBS) (Life Technologies), 1% L-glutamine and 1% penicillin/streptomycin ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were then pelleted and resuspended in BMDM media [high glucose Dulbecco’s Minimum Essential Media (DMEM) (Genentech) + 10% FBS (VRW, custom manufactured for Genentech) + GlutaMAX (Gibco, 30050-061) + Pen/Strep (Gibco ...
-
bioRxiv - Microbiology 2020Quote: ... and 293T were cultured in high-glucose DMEM (HyClone) supplemented with 10% heat-inactivated fetal bovine serum (HI-FBS, ThermoFisher Scientific), 100 U/ml penicillin-G ...
-
bioRxiv - Cell Biology 2021Quote: ... pH 10) prior to fractionation by high pH reversed-phase chromatography using an Ultimate 3000 liquid chromatography system (Thermo Fisher Scientific). In brief ...
-
bioRxiv - Cancer Biology 2021Quote: ... All these cell lines were cultured in Dulbecco’s Modified Eagle’s medium (DMEM High Glucose; Hyclone, USA) containing 10% fetal bovine serum (FBS) (Gibco, New York, USA), 1% (v/v ...
-
bioRxiv - Cancer Biology 2022Quote: ... pH 10) prior to fractionation by high pH reversed-phase chromatography using an Ultimate 3000 liquid chromatography system (ThermoFisher Scientific, Inc). In brief ...
-
bioRxiv - Cell Biology 2022Quote: ... pH 10) prior to fractionation by high pH reversed-phase chromatography using an Ultimate 3000 liquid chromatography system (Thermo Fisher Scientific). In brief ...
-
bioRxiv - Neuroscience 2023Quote: ... pH 10) prior to fractionation by high pH reversed-phase chromatography using an UltiMate® 3000 liquid chromatography system (Thermo Scientific). For reversed-phase chromatography ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were cultured until 80% confluent in high-glucose DMEM with 10% FBS containing penicillin and streptomycin and 0.5 mg/mL of G418 (Gibco, Thermo Fisher) at 37°C ...
-
bioRxiv - Cell Biology 2023Quote: ... 33) was used for tagmentation and amplified by 10 cycles of PCR using Phusion High-Fidelity DNA Polymerase(Thermo Scientific, #M0530) and following primers(5’-AATGATACGGCGACCACCGAGATCTACACindexGTTCAGAGTTCTACAGTCCG A-3’ ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... H10,14,243F GPR65 or B2AR N-terminally tagged with FLAG were cultured in DMEM high glucose (Cytiva, SH3024301) supplemented with 10% fetal bovine serum (FBS; Gibco, 26140079). Stable cell lines expressing one of the constructs were generated using Geneticin (Gibco ...
-
bioRxiv - Microbiology 2023Quote: ... pH 10) prior to fractionation by high pH reversed-phase chromatography using an Ultimate 3000 liquid chromatography system (Thermo Fisher Scientific). In brief ...
-
bioRxiv - Genomics 2023Quote: ... MDA-MB-231 cells were cultured in DMEM high-glucose medium with 10% FBS (Thermo Fisher Scientific or R&D Systems). Doxycycline-inducible GATA3 expression system in MDA-MB-231 cells was developed by lentiviral transduction ...
-
bioRxiv - Biochemistry 2023Quote: ... 5 µg of non-phospho or phospho-CTD peptide (per condition) was conjugated to 10 µL (per condition) high-capacity streptavidin agarose beads (Cat#20357, Thermo Scientific) in peptide binding buffer (10 mM Tris-HCl pH 7.5 ...
-
bioRxiv - Bioengineering 2023Quote: Green fluorescent protein (GFP)-reporting MDA-MB-231 mammary carcinoma cell line was cultured in cancer cell growth medium (DMEM [high glucose] medium supplemented with 10% FBS [Thermo Fisher Scientific] and 1% penicillin/streptomycin [Corning]) ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... HEK293T cells (ATCC® CRL-1573™) were cultured in DMEM plus L-glutamine (high glucose) supplemented by 10% FBS (Gibco) and penicillin/streptomycin (Gibco) ...
-
bioRxiv - Neuroscience 2024Quote: ... Clarified supernatants were analyzed (10 µL per injection) by ultra-high-pressure liquid chromatography coupled to mass spectrometry on a Vanquish UHPLC (Thermo Fisher) coupled to a Q Exactive mass spectrometer (Thermo Fisher ...
-
bioRxiv - Genetics 2024Quote: ... Full length coding sequences of CYP9K1 was amplified separately from cDNA of 10 mosquitoes using the Phusion high fidelity DNA polymerase (Thermo Scientific) (primers sequences ...
-
Aromatase in adipose tissue exerts an osteoprotective function in male mice via phosphate regulationbioRxiv - Physiology 2024Quote: ... 2019) was used for tagmentation and amplified by 10 cycles of PCR using Phusion High-Fidelity DNA Polymerase (Thermo Scientific, #M0530). 51bp of insert read (Read2 ...
-
bioRxiv - Immunology 2022Quote: ... and IL-10 Mouse Uncoated ELISA Kit (88-7105-86, Invitrogen), respectively ...
-
bioRxiv - Bioengineering 2021Quote: The Neon™ Transfection System 10 μL kit (Thermo Fisher Scientific) was used to transfect K562 and K562 BFP reporter cells according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2021Quote: Cells were electroporated with the Neon Transfection 10 μL Kit (Invitrogen) per the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2020Quote: ... 10 μL Maxima SYBR Green brilliant PCR amplification kit (Thermo Scientific), 5 uL forward and reverse primer mix (2 nM) ...
-
bioRxiv - Genetics 2023Quote: ... along with Neon Transfection System 10 μL Kit (Cat#MPK1096 Invitrogen). The reprogramming cocktail was prepared by adding 10 μL buffer T ...
-
bioRxiv - Cell Biology 2024Quote: ... followed by its reaction with detection reagents (ECL Western Blotting Detection Reagents, GE Healthcare or SuperSignalTM West Dura, Thermo Fisher Scientific). The primary antibodies used and their dilutions are listed in Supplementary file 3 ...
-
bioRxiv - Molecular Biology 2024Quote: ... membranes were briefly rinsed with PBS and then subjected to detection using SuperSignal WestPico Plus ECL-based detection (ThermoFisher, cat# 34580). Finally ...
-
bioRxiv - Microbiology 2019Quote: ... PCR amplicons were cleaned and normalized using SequalPrep Plate Normalization Kit (Invitrogen, Carlsbad, CA, USA) and combined into four pools ...
-
bioRxiv - Microbiology 2022Quote: ... The amplicons were normalized using a SequalPrep™ Normalization Plate Kit (Thermo Fisher Scientific Inc.) and multiplexed.
-
bioRxiv - Microbiology 2019Quote: ... Plates were scraped and transformant plasmids isolated using the GeneJET plasmid purification kit (Thermo scientific).
-
bioRxiv - Microbiology 2022Quote: ... Sample normalization of the indexed amplicons was performed with the SequalPrep normalization plate kit (ThermoFisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... and successfully amplified libraries were normalized using SequalPrep™ Normalization Plate Kit (Thermo Fisher, USA). Normalized amplicons were then pooled and concentrated 20:1 using the 50K Dalton Millipore filters (Sigma-Aldrich ...
-
bioRxiv - Microbiology 2023Quote: ... PCR products were cleaned and normalized using the SequalPrep Normalization Plate Kit (Invitrogen, Massachusetts, USA) according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... ELISA plates (96-well plates, Immunol4HBX, Thermo Fisher) were coated with a 50/50 mixture of His-Spy-RBD and RBD-Spy-His (2 μg/mL ...
-
bioRxiv - Microbiology 2019Quote: ... SAB agar plates (5-cm plates, Fisher Scientific) inoculated with 200 μL of a M ...
-
bioRxiv - Bioengineering 2020Quote: 96-well plates (Nunc MediSorp plates; Thermo Scientific) were coated overnight at 4 °C with 50 ng/well of purified antigen (recombinant RSVF or designed immunogens ...
-
bioRxiv - Bioengineering 2020Quote: 96-well plates (Nunc MediSorp plates; Thermo Scientific) were coated overnight at 4 °C with 50 ng/well of purified antigen (recombinant RSVF or designed immunogens ...
-
bioRxiv - Immunology 2020Quote: ... Maxisorb 96-well plates (Nunc-immuno plates, Dutscher) were coated overnight at room temperature (RT ...
-
bioRxiv - Immunology 2022Quote: ... Nunc Immuno Plate MaxiSorp plates (Thermo Fisher Scientific) were coated either with 50 μg/ml NP4-BSA or 50 μg/ml NP26-BSA and incubated overnight at 4°C ...
-
bioRxiv - Bioengineering 2023Quote: ... Custom PCR plates (TaqMan 96 well-plate, ThermoFisher) were used to assess mRNA expression on a QuantStudio 12K Flex Real-Time PCR System (ThermoFisher ...
-
bioRxiv - Cancer Biology 2021Quote: ... Isolated RNA was transcribed into cDNA using the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Darmstadt, Germany). For this ...