Labshake search
Citations for Thermo Fisher :
401 - 450 of 10000+ citations for Very Low Density Lipoprotein Receptor VLDLR Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2019Quote: ... and plated to a density of 75k/Cm2 on Geltrex (A1413201, ThermoFisher) coated coverslips (200 µg/cm2 ...
-
bioRxiv - Molecular Biology 2019Quote: ... grown to 50 % density and transfected using Lipofectamine 3000 (Thermo Fisher Scientific) according to the manufacturer’s protocol.
-
bioRxiv - Developmental Biology 2022Quote: ... re-plated at clonal density on mouse embryonic fibroblasts (irradiated; Gibco A34180), after which individual clonal colonies were picked and genotyped ...
-
bioRxiv - Molecular Biology 2022Quote: ... were run with 1X Hi-Density TBE Sample Buffer (Thermo Fisher # LC6678) and 1X TBE Running Buffer ...
-
bioRxiv - Cell Biology 2023Quote: ... Optical densities were measured using a spectrophotometer (NanoDrop OneC, Thermo Fisher Scientific).
-
bioRxiv - Cancer Biology 2023Quote: ... The concentration of DNA was assessed via optic density (Nanodrop spectrophotometer, Thermofisher) and 260/280 and 260/230 ratios were calculated ...
-
bioRxiv - Biophysics 2024Quote: ... with 2.5 μl Novex™ Hi-Density TBE Sample Buffer (5X) (Invitrogen). The gel was run in 0.5x TBE buffer at 120 V for 42 min and stained with 1x SYBR™ Gold Nucleic Acid Gel Stain (Invitrogen ...
-
bioRxiv - Molecular Biology 2023Quote: ... grown to 50 % density and transfected using Lipofectamine 3000 (Thermo Fisher Scientific) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2024Quote: ... They can grow to high density in Expi293™ Expression Medium (Gibco) with queuine added directly to the medium at a final concentration of 10 nM ...
-
bioRxiv - Bioengineering 2021Quote: ... platelet-derived growth factor receptor A (PDGFRA) and type I collagen (COL1A1) (Thermo Fisher, Waltham, Massachusetts). Probe references ...
-
bioRxiv - Immunology 2022Quote: ... HEK 293T cells expressing ACE2 receptors were suspended using TrypLE Select Enzyme solution (Thermo Fisher Scientific) and immediately added to all wells (10,000 cells in 100 μl of growth medium per well) ...
-
bioRxiv - Immunology 2020Quote: Human mannose receptor (CD206) siRNA (UACUGUCGCAGGUAUCAUCCA) or a non-targeting siRNA sequence control (4390843, Life Technologies) were transfected into HMDM (RNAiMax ...
-
bioRxiv - Neuroscience 2021Quote: ... surface receptors were labeled with Pierce™ Premium Grade Sulfo NHS-SS-Biotin (Thermofisher, Waltham, USA) and purified using Streptavidin High Performance Spintrap™ (Sigma-Aldrich ...
-
bioRxiv - Biochemistry 2020Quote: Receptor and chemokine baculovirus stocks were produced using the Bac-to-Bac Baculovirus Expression System (Invitrogen). Briefly ...
-
bioRxiv - Neuroscience 2023Quote: Stably expressing 5-HT receptor Flp-In 293 T-Rex Tetracycline inducible system (Invitrogen, mycoplasma-free) were used for calcium flux assays ...
-
bioRxiv - Evolutionary Biology 2023Quote: The chemicals used for the deorphanization of receptors were obtained from Acros Organics (Morris, NJ, USA), Alfa Aesar (Ward Hill ...
-
bioRxiv - Biochemistry 2023Quote: ... Cells were then transiently transfected with receptor constructs using LipofectamineTM 2000 transfection system (ThermoFisher, cat# 11668019). Briefly ...
-
bioRxiv - Cell Biology 2024Quote: ... and IGF-1 receptor (Catalog number: AM51331, siRNA ID:110754) with Lipofectamine RNAiMax Transfection Reagent (Invitrogen), according to manufacturer’s established protocol ...
-
bioRxiv - Microbiology 2020Quote: ... 5µL of Luminaris HiGreen low Rox qPCR Master Mix (Thermo Scientific) and nuclease free water (Thermo Scientific ...
-
bioRxiv - Cell Biology 2020Quote: ... and then transferred to a low bind microcentrifuge tube (Fisher Scientific). The suspension was then spined for 5 min at 300 g at 4 °C ...
-
bioRxiv - Microbiology 2020Quote: ... RiboRuler High Range and Low Range RNA ladders (Thermo Fisher Scientific) were marked by UV-shadowing ...
-
bioRxiv - Developmental Biology 2019Quote: ... After several low speed washes in ADF-12 (#12634-010, Gibco), isolated crypts were resuspended and plated in Matrigel (#354230 ...
-
bioRxiv - Genomics 2019Quote: ... Expansion medium was composed of DMEM-low glucose (Thermo Fisher Scientific), 1% penicillin/streptomycin (Thermo Fisher Scientific) ...
-
bioRxiv - Genomics 2019Quote: ... The biopsy was embedded in low melting point agarose (Thermo Fisher) and 40 μm thick sections were prepared using a vibratome (VT1200 S Leica ...
-
bioRxiv - Developmental Biology 2020Quote: ... The differentiation media consisted of low glucose DMEM (Thermo Fisher scientific) supplemented with 15% fetal bovine serum (FBS ...
-
bioRxiv - Bioengineering 2021Quote: ... pluronic F-127 (low ultraviolet (UV) absorbance) (P6867, Thermo Fisher Scientific), tetrodotoxin (TTX ...
-
bioRxiv - Neuroscience 2021Quote: ... embedded in 1.5-2% low melting point agarose (LMP, Fisher Scientific) in a recording chamber (Fluorodish ...
-
bioRxiv - Cell Biology 2021Quote: ... in a medium consisting of 60% DMEM-low glucose (Life Technologies) and 40% MCDB-201 (Sigma-Aldrich) ...
-
bioRxiv - Cell Biology 2021Quote: ... consisting of Dulbecco’s modified Eagle’s medium-low glucose (Thermo Fisher Scientific) supplemented with 10% human platelet lysate ...
-
bioRxiv - Cell Biology 2021Quote: ... C2C12 differentiation media consisted of low-glucose DMEM (Gibco No. 11885), 2% horse serum (Hyclone No ...
-
bioRxiv - Biochemistry 2022Quote: ... low-magnification grid overviews (atlases) were collected using EPU (Thermofisher Scientific). Afterwards ...
-
bioRxiv - Immunology 2022Quote: ... Tissues were embedded and oriented in 4% low-melting agarose (Invitrogen) in PBS and cut into 60 to 80 um sections using a vibratome (VT-1200 ...
-
bioRxiv - Microbiology 2022Quote: ... and subsequently transferred to a low-fluorescence PVDF membrane (Thermo Scientific) in transfer buffer containing 10% methanol and 0.5% SDS overnight at 4°C ...
-
bioRxiv - Neuroscience 2020Quote: ... embryos were mounted in 1% low-melting-point agarose (16520050; Invitrogen) dissolved in embryo water ...
-
bioRxiv - Microbiology 2022Quote: ... Low ROX (Quanta Biosciences) reagent and QuantStudio 6 Flex (Applied Biosystems). The manufacturers’ recommended protocols were used ...
-
bioRxiv - Genetics 2021Quote: ... 0.5% (v/v) Tween 80 (Surfact-Amps, low peroxide; Thermo Fisher), 50 nM Horseradish Peroxide (Sigma) ...
-
bioRxiv - Bioengineering 2020Quote: ... were grown in low-glucose Dulbecco’s modified Eagle medium (DMEM; Gibco), supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Genomics 2021Quote: ... 50 µl of ‘Ultra Low Range Ladder’ (ULR, Thermo Fisher Scientific) will be size selected in parallel to monitor ProNex size selection efficiency ...
-
bioRxiv - Genetics 2020Quote: Samples were mounted in 1% low melting point (LMP) agarose (Invitrogen) and imaged with a Leica SP5II confocal microscopy (Leica LAS software ...
-
bioRxiv - Developmental Biology 2020Quote: ... and cultured in low-glucose DMEM with GlutaMAX supplement (Gibco 10567022) and 10% mesenchymal stem cell-qualified FBS (Gibco 12662029 ...
-
bioRxiv - Developmental Biology 2021Quote: ... and then embedded in 1% low melting point agarose (Invitrogen 16520050). Imaging was performed with Zeiss 880 Airyscan confocal under the standard Airyscan mode ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... fly heads were stabilized with 1,5% low melting agarose (Thermo Scientific) in Ringer’s solution ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were differentiated in low-serum differentiation medium (Thermo Scientific, 41965039), supplemented with 2% horse serum (Thermo Scientific ...
-
bioRxiv - Biochemistry 2021Quote: ... and low protein binding microcentrifuge tubes were purchased from Thermo Fisher Scientific (Waltham ...
-
bioRxiv - Microbiology 2020Quote: ... molecular weight markers were RiboRuler Low Range RNA Ladder (Thermo Scientific) or 10 bp DNA Ladder (Invitrogen) ...
-
bioRxiv - Microbiology 2020Quote: ... Washed mosquitoes were embedded in 1.3% ultrapure low-melting agarose (Invitrogen) in deionized water ...
-
bioRxiv - Immunology 2020Quote: ... Spleens were embedded in 4% low melting agarose (Thermo Fisher Scientific) in PBS and sectioned with a vibratome (Leica VT-1000 S ...
-
bioRxiv - Cell Biology 2021Quote: ... pre-warmed low melting dose of agarose (Thermofisher Scientific, Cat#16520050) was injected into the lung through the mainstem bronchus until the lung was fully inflated ...
-
bioRxiv - Immunology 2022Quote: ... low passage (< P15) cell lines were detached using 0.05% trypsin (GIBCO) and washed once with complete DMEM media ...
-
bioRxiv - Biochemistry 2022Quote: Low pHi: Complete media supplemented with 25 μM EIPA (Invitrogen, E3111)