Labshake search
Citations for Thermo Fisher :
451 - 500 of 10000+ citations for Very Low Density Lipoprotein Receptor VLDLR Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... 10x low pH antigen retrieval solution (Thermo Scientific, #00-4955-58) was diluted in purified water and preheated for 10 minutes in a microwave ...
-
bioRxiv - Developmental Biology 2022Quote: Oocytes were mounted in 0.7% low-melting-point (LMP) agarose (Invitrogen) inside a glass bottom Petri dish (MatTek ...
-
bioRxiv - Microbiology 2023Quote: ... RiboRuler High Range and Low Range RNA ladders (Thermo Fisher Scientific) were marked by UV-shadowing ...
-
bioRxiv - Microbiology 2023Quote: ... RiboRuler High Range and Low Range RNA ladders (Thermo Fisher Scientific) were marked by UV-shadowing ...
-
bioRxiv - Neuroscience 2023Quote: ... and collected in low protein binding microcentrifuge tubes (Thermo Scientific, 90410). Cells were pelleted by centrifugation at 1 000 x g for 5 min at 4 °C ...
-
bioRxiv - Neuroscience 2023Quote: ... was embedded in low-melting point agar (∼3%; Thermo Fisher Scientific) and parasagittal slices were cut with a vibrating blade microtome (Thermo Scientific ...
-
bioRxiv - Cancer Biology 2023Quote: ... cells were plated in ultra-low attachment (ULA) plates (ThermoFisher Scientific). The size of the spheroids was calculated by measuring two orthogonal diameters (d1 and d2) ...
-
bioRxiv - Developmental Biology 2023Quote: ... brains were embedded in 3% low melting point agarose (Invitrogen, 16520100) and cut on a vibratome into 250 μm-thick slices ...
-
bioRxiv - Neuroscience 2023Quote: ... in 2% low-melting agarose (Fisher Scientific, Cat. No. BP160-100) surrounded by egg water ...
-
bioRxiv - Cell Biology 2023Quote: ... CC group was treated with low glucose addition (Thermo Fisher, USA)/ 12.5 μg/mL Calcitriol (Aladdin ...
-
bioRxiv - Cancer Biology 2023Quote: ... supplemented with 10% ultra-low IgG fetal bovine serum (Thermo Fisher), 100 units/mL penicillin ...
-
bioRxiv - Cancer Biology 2023Quote: ... Stealth non-silencing Low-GC RNA duplexes (sictl, CGACAAUUGUGAGGUCUAAACUAUU, Life Technologies) were used as non-silencing control.
-
bioRxiv - Molecular Biology 2022Quote: ... followed by expansion in low glucose Dulbecco’s Modified Eagle’s Medium (Gibco, 31885-023 or Biological Industries (BI) ...
-
bioRxiv - Physiology 2023Quote: ... Organs were then embedded in 6% agarose low melting gel (Invitrogen), and organ sections (100 μm ...
-
bioRxiv - Cancer Biology 2023Quote: ... maintained at low passages and passaged using 0.25X Trypsin EDTA (Invitrogen). Cells lacking Setdb1 were achieved by CRISPR/Cas9 gene editing using sgRNAs selected from the Brie library(Joung et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... containing 2% low serum growth supplement (LSGS, Gibco, Grand Island, NY) or endothelial cell medium (ECM ...
-
bioRxiv - Developmental Biology 2023Quote: ... and embedded UltraPure 1% low melt agarose (Thermo Fisher, Catalog #16520100) in 1X embryo media in PELCO Glass Bottom Petri Dishes (Ted Pella ...
-
bioRxiv - Biochemistry 2023Quote: ... and polyethylenimine (PEI) transfection reagent in OptiMEM low serum media (Gibco) according to addgene protocol ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: ... BCA protein assay and low melt agarose were from Thermo Fisher Scientific (Waltham ...
-
bioRxiv - Cell Biology 2024Quote: ... proteins were transferred to Low-Fluorescence PVDF Transfer Membranes (Thermo Scientific) and blocked in 3% BSA in PBS ...
-
bioRxiv - Neuroscience 2023Quote: ... embedded laterally in 1.2% low-melting-point (LMP) agarose (Invitrogen, 16520), and imaged live on a Zeiss LSM 700 inverted confocal microscope ...
-
bioRxiv - Microbiology 2024Quote: ... RiboRuler High Range and Low Range RNA ladders (Thermo Fisher Scientific) were marked by UV-shadowing ...
-
bioRxiv - Cell Biology 2024Quote: ... Freshly isolated cells were cultured in low-glucose DMEM (Invitrogen, USA) supplemented with 10% FBS (ExCell Bio ...
-
bioRxiv - Immunology 2023Quote: ... TEP were aggregated in low binding 96-well plates (ThermoFisher, 174929), at a 8:1 ratio with fresh ETP sorted as described above ...
-
bioRxiv - Cancer Biology 2024Quote: ... and subsequently normalized to 1.5 nM using Low TE buffer (Invitrogen). The 1.5 nm pool was denatured using 0.2N NaOH according to Illumina guidelines for 8 minutes at room temperature ...
-
bioRxiv - Microbiology 2020Quote: ... cells expressing the surface CD4 receptor were enriched using the Dynabeads CD4 cell isolation kit (Life Technologies). They were seeded to develop single cell-derived clones ...
-
bioRxiv - Microbiology 2021Quote: ... JCRB #1818) cells expressing the ACE2 or ACE and TMPRSS2 receptors respectively were cultured in DMEM (Gibco) supplemented with 5 % FBS (Fetal Bovine Serum) ...
-
bioRxiv - Molecular Biology 2022Quote: ... cells were transfected with pCMV6 vectors bearing WT or mutant receptors using Lipofectamine 3000 transfection reagent (Invitrogen). Following 24 h culturing ...
-
bioRxiv - Immunology 2023Quote: ... Fc receptors were blocked by incubating cells with 1:50 anti- mouse CD16/CD32 (Fc block, Invitrogen) for 10 minutes at 4°C ...
-
bioRxiv - Microbiology 2019Quote: ... DNA was measured in 24 density gradient fractions using QuBit (Invitrogen, MA, USA). Syntrophomonas 16S rRNA genes were quantified in gradient fractions as described by Ziels et al ...
-
bioRxiv - Neuroscience 2020Quote: ... at a density of 225 cells/mm2 in Neurobasal Medium (Thermo Fisher Scientific) supplemented with 1xB27 (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2019Quote: ... cells were seeded at appropriate density in imaging dishes (Nunc, Lab-Tek, 155361) and dual HaloTag labeling protocol (see details above ...
-
bioRxiv - Neuroscience 2022Quote: ... Live cell density was determined using the Countess 3 automated cell counter (ThermoFisher) and cells were plated onto 8 well chamber slides at a density of 43,000 cells/cm2 and cultured in an incubator at 37 °C / 5 % CO2 ...
-
bioRxiv - Developmental Biology 2022Quote: ... cells were replated at required density following dissociation with Accutase (ThermoFisher, cat. A1110501). Cells were grown in 2iLIF culture conditions ...
-
bioRxiv - Cell Biology 2022Quote: ... at a density of 25-40 × 103 cells/cm2 in Neurobasal media (Gibco) supplemented with 2 mM GlutaMax ...
-
bioRxiv - Genetics 2020Quote: ... reactions were diluted with Novex Hi-Density TBE Sample Buffer (Thermo Fisher LC6678), and run on precast TBE gels ...
-
bioRxiv - Cell Biology 2019Quote: ... Cell density was calculated using Countess II FL Automated Cell Counter (ThermoFisher Scientific). To induce the NPC differentiation ...
-
bioRxiv - Genetics 2019Quote: ... then resuspended at a density of 6×108 cells/mL in RNAlater (Ambion) for 45 min in two separate conical tubes ...
-
Loss of TREM2 reduces hyperactivation of progranulin deficient microglia but not lysosomal pathologybioRxiv - Neuroscience 2021Quote: ... Cells were separated on a density gradient using Ficoll-Paque PLUS (ThermoFisher, #11768538). After centrifugation isolated cells were washed with PBS supplemented with 2% FCS ...
-
bioRxiv - Developmental Biology 2021Quote: ... were thawed onto high-density mouse (ICR) inactivated embryonic fibroblasts (MEFs, Gibco; A24903) plates using NaïveCult expansion media (Stemcell Technologies ...
-
bioRxiv - Microbiology 2020Quote: ... Cell density was determined by monitoring absorbance with a Spectronic 200 (Thermo Scientific) or a SmartSpec Plus (Bio-Rad ...
-
bioRxiv - Microbiology 2020Quote: ... Cell density was determined by monitoring absorbance with a Spectronic 200 (Thermo Scientific) or a SmartSpec Plus (Bio-Rad ...
-
bioRxiv - Immunology 2022Quote: ... at a density of 7×105 Caco2 cells/well containing EMEM (Gibco BRL) medium supplemented with 20% FBS ...
-
bioRxiv - Molecular Biology 2022Quote: ... Cells were seeded at a density of 80-90 % into chamber slides (Nunc) and fixed after 24 h with 4% paraformaldehyde at room temperature for 15 min ...
-
bioRxiv - Microbiology 2022Quote: ... with a growth density of up to 80% in complete DMEM medium (Gibco), were digested with trypsin and resuspension in fresh medium at a concentration of 2 ×105 cells/ml.1ml suspension was added to each well in 6-well plates and incubated at 37 □ in a 5% atmospheric CO2 environment until the cells were grown to 80% confluence ...
-
bioRxiv - Microbiology 2023Quote: Optical density at 600nm (OD600) was measured on a Genesys40 spectrophotometer (Thermo Fisher) relative to uninoculated growth medium blanks in either cuvettes or test tubes where appropriate ...
-
bioRxiv - Genetics 2023Quote: ... HEK293T cells were plated at a density ∼60,000 cells/cm2 in DMEM (Invitrogen) supplemented with penicillin/streptomycin/glutamine (Invitrogen) ...
-
bioRxiv - Neuroscience 2023Quote: ... at a density of 25-40 × 103 cells/cm2 in Neurobasal media (Gibco) supplemented with 2 mM GlutaMax ...
-
bioRxiv - Cell Biology 2023Quote: ... at a density of 2x105 cells per well in maintenance medium (WEM, GIBCO), supplemented with primary hepatocyte maintenance supplements (GIBCO ...
-
bioRxiv - Neuroscience 2023Quote: ... and cell density and viability assessed using Trypan Blue (Invitrogen, cat. no T10282) in an automated cell counter (Countess II ...