Labshake search
Citations for Thermo Fisher :
401 - 450 of 5279 citations for TNF beta Human since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... or anti-human (Invitrogen) horseradish peroxidase-conjugated antibodies were diluted 1:5,000 and 25 μL added to each well and incubated at 37°C for 1 h ...
-
bioRxiv - Microbiology 2021Quote: ... or human IgG (Invitrogen) as control ...
-
bioRxiv - Bioengineering 2022Quote: ... and human fibronectin (Gibco) at 50 μg/mL in PBS ...
-
bioRxiv - Cell Biology 2022Quote: ... human (ThermoFisher Scientific, 902927). Analysis was performed with Transcriptome Analysis Console 4.0 software (Applied Biosystems ...
-
bioRxiv - Immunology 2022Quote: ... then anti-human (Invitrogen) horseradish peroxidase-conjugated antibodies were diluted 1:5,000 and 50 μL added to each well and incubated at 37°C for 1 h ...
-
bioRxiv - Developmental Biology 2023Quote: ... 1% human IgG (Invitrogen) in PBS] followed by incubation with primary antibodies ...
-
bioRxiv - Cell Biology 2023Quote: ... human plasma (ThermoFisher, #33016015); Laminin 111 ...
-
bioRxiv - Immunology 2023Quote: ... A Human ProcartaPlexTM (Invitrogen) immunoassay was additionally used to detect 45 human cytokines ...
-
bioRxiv - Immunology 2024Quote: ... Anti-Human-HRP (Invitrogen) was diluted 1:5000 in 1% BSA/PBS ...
-
bioRxiv - Molecular Biology 2024Quote: ... CD36 (Human tissue Thermofisher: PA1-16813 1:500 ...
-
bioRxiv - Bioengineering 2020Quote: ... The blood samples were then centrifuged at 2000 xg for 10 minutes and serum collected for TNF determination by ELISA (Invitrogen, Carlsbad, CA) following the manufacturer’s instructions.
-
bioRxiv - Systems Biology 2020Quote: ... Cells were hybridized for 12 hours overnight with the following probe set specific conditions: 250 nM probe for Tnf/Il6/Csf2 in 2X SSC (Thermo Fisher Scientific) with 10% formamide (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2024Quote: ... Samples were tested on preconfigured 96-well qPCR plates (Human glycosylation – 4413255, Human Inflammation - 4418851 or Human tumor metastasis – 4418743, Thermofisher Scientific), with 100 ng added to each well ...
-
bioRxiv - Biochemistry 2019Quote: ... The reaction was quenched by adding 5mM beta-mercaptoethanol and desalted to remove unreacted dye (ThermoFisher, 7K MWCO). The extent of labelling was quantified by measuring the 595nm/280nm absorbance ratio ...
-
bioRxiv - Biochemistry 2021Quote: ... for spike protein or RBD detection and mouse anti-beta tubulin antibody (1:5000; Thermo Fisher; MA5-16308) as a loading control ...
-
bioRxiv - Cell Biology 2021Quote: A rat beta cell line (INS1E, AdexxBio C0018009) at passage 38–46 was cultured in RPMI (Gibco 21875) supplemented with 5% (v/v ...
-
bioRxiv - Neuroscience 2021Quote: ... The reaction was stopped following the addition of 4x sample buffer (containing 10% beta mercaptoethanol (BME; Thermo Fisher)) to each well and heated to 95°C for 10 min ...
-
bioRxiv - Microbiology 2022Quote: ... Western blotting for GATA3 and Beta-Actin was carried out by lysing the cells with RIPA buffer (ThermoFisher) supplemented with benzonase and protease inhibitors ...
-
bioRxiv - Cancer Biology 2023Quote: ... Treatment with the vehicle hydroxypropyl-beta-cyclodextrin (HPBCD, Acros Organics; 5% w/w in water for injection (WFI)) ...
-
bioRxiv - Microbiology 2020Quote: ... we used human monoclonal antibodies produced recombinantly in human Expi293F cells (Life Technologies) as described before (Fang et al ...
-
bioRxiv - Cell Biology 2021Quote: ... anti-human IgG-Alexa647 and anti-human IgG-Alexa568 were obtained from Invitrogen, anti-acetylated tubulin (T7451 ...
-
bioRxiv - Cell Biology 2020Quote: ... and human GAPDH and human KIF18A Taqman probes and primers (Thermo Fisher Scientific) were used for reverse transcription and qRT-PCR ...
-
bioRxiv - Neuroscience 2020Quote: ... and subjected to human total tau ELISA (human tau: # KHB0042, Thermo Fisher Scientific) according to manufacturer’s instructions.
-
bioRxiv - Cell Biology 2021Quote: Primary human vein endothelial cells (HUVECs) were cultured in human endothelial SFM medium (Invitrogen) containing 20% foetal bovine serum ...
-
bioRxiv - Cell Biology 2020Quote: ... Human CD4+ T cells were activated by Dynabeads Human T-Activator CD3/CD28 (ThermoFisher) and cultured in AIMV medium (ThermoFisher ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells are differentiated for 4 days in embryonic body (EB) differentiation medium (DMEM/F12 [Hyclone], 20% FBS, NEAA [1×, GIBCO], GlutaMAX [1×, GIBCO], 0.1% beta-Mercaptoethanol [GIBCO]). For mixed embryonic body (EB ...
-
bioRxiv - Genomics 2019Quote: ... with 1% beta-mercaptoethanol for Smart-seq2 and 384-well plates containing 0.6 µl 1% NP40 (Thermo Fisher Scientific) for CEL-Seq2.
-
bioRxiv - Cancer Biology 2020Quote: ... Tumor-bearing mice were administered 25 mg/ kg of MeTC7 or vehicle control (40% Hydroxypropyl-beta-cyclodextrin [Acros Organics] & solutol HS15 [Sigma] in sterile water ...
-
bioRxiv - Cancer Biology 2020Quote: ... Quantitative PCR was performed using TaqMan probes (DR4: Hs00269492_m1, DR5: Hs00366278_m1, beta-2-microglobulin: Hs00187842_m1) and TaqMan Gene Expression Master Mix (Life Technologies Limited) as per the manufacture’s protocol ...
-
bioRxiv - Neuroscience 2021Quote: ... a staining solution of 1 mg/mL 5-bromo-4-chloro-3-indolyl-beta-d-galactopyranoside (X-gal, Invitrogen), 1× citratesodium phosphate buffer (pH 6.0) ...
-
bioRxiv - Neuroscience 2021Quote: ... Primary antibodies for one series included rabbit anti-beta Amyloid (1:300, Cat# 715800, Lot# SH257822; Invitrogen, Waltham, MA). Primary antibodies for another series included rat anti-glial fibrillary acidic protein (1:2500 ...
-
bioRxiv - Microbiology 2021Quote: ... TATA-box binding protein (TBP) (Hs00427620_m1) and beta-2-microglobulin (B2M) (Hs00187842_m1) was used (all from Thermo Fisher Scientific). PCR was performed using the LightCycler 480 Instrument (Roche Life Science ...
-
bioRxiv - Cell Biology 2021Quote: ... first dimensional lanes are cut from the gel and incubated in 1% SDS with 1% beta-mercaptoethanol for 1 hour before the gel slice was loaded into an NuPAGE 4-13% 1.0mmx2D gel (Invitrogen). Gels were run at 200V for 50 minutes at room temperature in MOPS ...
-
bioRxiv - Microbiology 2020Quote: ... was suspended in 600 μL of Qiagen RLT lysis buffer supplemented with one percent beta-mercaptoethanol and 0.3 U/μL Superase-In (Invitrogen). The suspension was subjected to bead beating for 3 minutes using 1.0 mm Zirconia/Silica beads ...
-
bioRxiv - Microbiology 2020Quote: ... Bacterial pellets were suspended in 600 μL Qiagen RLT lysis buffer supplemented with one percent beta-mercaptoethanol and 0.3 U/μL Superase-In (Invitrogen). The suspension was subjected to bead beating for 3 minutes using 1.0 mm Zirconia/Silica beads ...
-
bioRxiv - Neuroscience 2022Quote: ... mice received a unilateral injection of cholera toxin beta subunit coupled to Alexa Fluor 594 (CTb-594, Invitrogen C34777). Mice were anesthetized with isoflurane and treated with proparacaine ophthalmic drops (1%) ...
-
bioRxiv - Neuroscience 2022Quote: ... Primer pairs specific to mouse RFC1/SLC19a1 (Mm00446220_m1) and Tubb4a (Mm00726185_s1, beta 4A class IVA as a housekeeping gene) were constructed and verified by Life Technologies to use with TaqMan qPCR chemistry (TaqMan™ Gene Expression Assay ...
-
bioRxiv - Cancer Biology 2023Quote: The MCF7 cells were grown in their aforementioned media (see section 2.3) and treated with 10nM beta-estradiol in DMEM no phenol red (Gibco), 2% charcoal-stripped FBS (cFBS) ...
-
bioRxiv - Biochemistry 2023Quote: ... 10x serial dilutions were made in 0.1% formic acid 0.1% n-Dodecyl-beta-Maltoside Detergent (DDM, Thermo Fisher, 89902) in LCMS grade water ...
-
bioRxiv - Neuroscience 2024Quote: ... Both fractions were then used to measure the amyloid beta 1-42 (Aβ1-42) using a specific ELISA kit (Invitrogen) following the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2021Quote: ... + 2% human serum albumin (ThermoFisher) + 5 μM ROCKi (Tocris) ...
-
bioRxiv - Cell Biology 2020Quote: ... Human GR-specific siRNA (Invitrogen) was used at a concentration of 100 nM for 48 h to effectively knock down GR ...
-
bioRxiv - Cancer Biology 2020Quote: ... Human primary melanocytes (Life Technologies) were grown in Medium 254 (Gibco ...
-
bioRxiv - Microbiology 2019Quote: ... including human 293FT cells (Invitrogen), rat2 cells (ATCC #CRL-1764) ...
-
bioRxiv - Physiology 2019Quote: ... human GDF15 (Hs00171132_m1 - ThermoFisher Scientific), human GAPDH (Hs02758991_g1 – ThermoFisher Scientific) ...
-
bioRxiv - Physiology 2019Quote: ... human GAPDH (Hs02758991_g1 – ThermoFisher Scientific), mouse HPRT (Forward – AGCCTAAGATGAGCGCAAGT ...
-
bioRxiv - Genetics 2019Quote: ... human COT-1 DNA (Invitrogen) and biotin-labeled mouse COT-1 or minor satellite DNA (a gift from Dr ...
-
bioRxiv - Genetics 2021Quote: ... human COT-1 DNA (ThermoFisher) to detect HSA21 and biotin-labeled I-EGFP-I-loxP-3’HPRT (ThermoFisher ...
-
bioRxiv - Bioengineering 2021Quote: ... recombinant human Vitronectin (Gibco A14700) was used at a final concentration of 25ug/ml ...
-
bioRxiv - Cancer Biology 2020Quote: Human recombinant IL-1β (ThermoFisher) was reconstituted in deionised water and administered at 10 ng/ml.