Labshake search
Citations for Thermo Fisher :
401 - 450 of 10000+ citations for Piggybac Transposable Element Derived 3 PGBD3 Antibody since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... The slides were washed 3 times with PBS and incubated with Alexa Fluor conjugated secondary antibodies (Invitrogen) for 2 hours at room temperature ...
-
bioRxiv - Immunology 2022Quote: ... 2 μm paraffin-embedded kidney sections were incubated with an anti-cleaved caspase-3 antibody (ThermoFisher Scientific). After incubation with goat anti-rabbit-HRP secondary antibody (ThermoFisher Scientific) ...
-
bioRxiv - Neuroscience 2022Quote: ... Slides were washed 3 × 10 min in TBS-T and secondary antibody incubation (1:750; Life Technologies) was performed for 1 hr ...
-
bioRxiv - Cancer Biology 2022Quote: ... The sections were incubated with primary antibody against Glypican 3 (Thermo Fisher Scientific, Cat. No. MA5-17083) and Ki-67 (Abcam ...
-
bioRxiv - Neuroscience 2022Quote: ... HLA-DR Antibody (Monoclonal Rabbit Anti-Human, Citrate Buffer HIER, dilution 1:50 Clone: LN-3, Invitrogen, Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were washed 3 times with 1X PBS and then incubated with AlexaFluor-conjugated secondary antibodies (Invitrogen) in 1% BSA in a humidified chamber at room temperature for 1 hr ...
-
bioRxiv - Physiology 2024Quote: ... Blots were washed 3×15 min in TBS-T and incubated with HRP-coupled secondary antibodies (ThermoFisher) diluted in 5% milk in TBS-T for 1h at RT ...
-
bioRxiv - Developmental Biology 2021Quote: ... and day 6 control and Pogz-/- ESC-derived EBs were collected and treated with Trizol (Invitrogen). RNAs were quantified by a Nanodrop instrument ...
-
bioRxiv - Molecular Biology 2021Quote: Approximately 2×105 iPSC derived microglial cells were harvested using TRIzol reagent (Ambion Life Technologies 15596018) for total RNA isolation ...
-
bioRxiv - Molecular Biology 2021Quote: Approximately 2×105 iPSC derived microglial cells were harvested using TRIzol reagent (Ambion Life Technologies 15596018) for total RNA isolation ...
-
bioRxiv - Bioengineering 2021Quote: ... platelet-derived growth factor receptor A (PDGFRA) and type I collagen (COL1A1) (Thermo Fisher, Waltham, Massachusetts). Probe references ...
-
bioRxiv - Neuroscience 2021Quote: ... 20 ng/ml glial cell-derived neurotrophic factor (GDNF) (all from Thermo Fisher Scientific, Massachusetts, USA), 100 ng/mL cAMP ...
-
bioRxiv - Cell Biology 2021Quote: ... Human Neural Stem Cells (hNSC) were obtained from ThermoFischer Scientific (Gibco™, ref#N7800100, H9-derived) and cultured as recommended using KnockOut™ DMEM/F-12 Basal Medium ...
-
bioRxiv - Cell Biology 2021Quote: Leishmania mexicana (MNYC/BZ/62/M379) derived strains were grown at 25°C in HOMEM (Gibco) supplemented with 10% (v/v ...
-
bioRxiv - Bioengineering 2022Quote: ... Expi293 cells (female-derived kidney cell line) were grown in Expi293™ Expression Medium (Thermo Fisher) at 37°C ...
-
bioRxiv - Cell Biology 2022Quote: HEK293T (LentiX) cells (female-derived kidney cell line) were grown in DMEM complete media (Thermo Fisher) supplemented with 10% FBS ...
-
bioRxiv - Molecular Biology 2022Quote: ... The cells were assessed with fluorescein isothiocyanate (FITC)-conjugated goat-derived IgG (Thermo Fisher Scientific, Waltham) at 1:500 dilution for 30 min ...
-
bioRxiv - Microbiology 2022Quote: ... hiPSC-derived cardiomyocytes (hiPSC-CMs) were maintained in RPMI-1640 supplemented with B-27 supplement (ThermoFisher). Heat-shock was performed at 42C for 30 min and on day 14 ...
-
bioRxiv - Cancer Biology 2022Quote: ... and multiple myeloma-derived cell lines NCI-H929 (ATCC) were cultured in RPMI 1640 medium (Gibco) supplemented with 10% FBS and 4 mM L-glutamine at 37°C in a humidified 5% CO2 atmosphere ...
-
bioRxiv - Biochemistry 2020Quote: ... and BY4741-derived GFP-gene fusions obtained from the Yeast GFP Clone Collection (Thermo Fisher Scientific) (80) ...
-
bioRxiv - Immunology 2020Quote: Proteins derived from cell lysates were separated on SDS-PAGE gel (4 to 12%) (Novex, Invitrogen) with 2-(N-morpholino ...
-
bioRxiv - Cell Biology 2021Quote: ... Nb48 sequence was cloned into the pcDNA3.1 C-terminus tag 3HA vector (derived from pCDNA3.1 Invitrogen) between NheI-XhoI restriction sites and expressed transiently as an intrabody ...
-
bioRxiv - Cell Biology 2023Quote: ... iPSC-derived neurons were cultured in BrainPhys Neuronal Media (StemCell) supplemented with 2% B-27 (GIBCO), 10 ng/mL BDNF (PeproTech) ...
-
bioRxiv - Cancer Biology 2023Quote: Genomic DNA of patient-derived organoids and matched WBC were isolated using SDS (Thermo Fisher, USA) method following the recommended instructions ...
-
bioRxiv - Neuroscience 2023Quote: NPCs and iPSC-derived neurons were dissociated using Accutase® Cell Dissociation Reagent (Thermo Fisher Scientific) incubated at 37°C for 5 minutes ...
-
bioRxiv - Bioengineering 2024Quote: ... C2C12 and HGPS patient derived cells were transfected using the Neon Electroporation System (Thermo Fisher Scientific) according to manufacturers instructions and seeded in a 24-well tissue culture plate (VWR ...
-
bioRxiv - Molecular Biology 2024Quote: Human iPSC-derived alveolospheres were harvested by incubating with 2 mg/ml dispase (Thermo Fisher Scientific) for 30-60 minutes at 37°C ...
-
bioRxiv - Molecular Biology 2024Quote: ... The PDX-derived cell lines MEL015_DTres and MEL015_ICBres were cultured in RPMI 1640 (Gibco BRL Invitrogen), supplemented with 10% FBS (Gibco BRL Invitrogen) ...
-
bioRxiv - Molecular Biology 2024Quote: ... The PDX-derived cell lines MEL015_DTres and MEL015_ICBres were cultured in RPMI 1640 (Gibco BRL Invitrogen), supplemented with 10% FBS (Gibco BRL Invitrogen) ...
-
bioRxiv - Microbiology 2024Quote: Colonoid-derived monolayers were fixed after 36 h co-culture by using 4 % PFA (Thermo Scientific), followed by membrane permeabilization with 0.3 % Triton-X (Thermo Scientific) ...
-
bioRxiv - Physiology 2023Quote: ... anti-human HLA-A,B,C to detect leukocyte derived EVs and Annexin V (ThermoFisher, UK), which binds externalized phosphatidylserine (PS ...
-
bioRxiv - Genomics 2023Quote: Commercially available human iPSC lines derived from a female donor (Gibco Episomal hiPSC, Gibco, catalog # A18945) and from a male donor (ChiPSC22 ...
-
bioRxiv - Immunology 2023Quote: ... bone marrow derived macrophages were plated on 8 well chamber coverslips (Nalge Nunc International, Cat. 155409) at a density of 2.85*105 cells / cm2 ...
-
bioRxiv - Cancer Biology 2022Quote: ... 23 Low-passage patient-derived GIN 28 and GCE 28 cells were cultured in DMEM (Gibco) supplemented with 10% FBS ...
-
bioRxiv - Cell Biology 2022Quote: ... RCH-ACV (and derived) human B cells were grown in RPMI culture medium (GIBCO, Cat#22400089) containing 20%-FBS (10270-106 ...
-
bioRxiv - Microbiology 2022Quote: C6/36 cells (derived from Aedes albopictus) were cultured in Leibovitz’s L-15 medium (Life Technologies) supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Physiology 2023Quote: ... for the donor the sequence encoding Gluc derived from pCMV-Gaussia Luc Vector (ThermoFisher Scientific #16147) was introduced at the N-terminus ...
-
bioRxiv - Immunology 2023Quote: ... Human monocyte-derived macrophages (HMDMs) were cultured in media consisting of RPMI 1640 medium (Life Technologies) supplemented with 10% heat-inactivated fetal bovine serum (FBS) ...
-
bioRxiv - Genetics 2024Quote: RNA derived from iPSCs was reverse transcribed using Random Primers and SuperScript II Reverse Transcriptase (Invitrogen) in a T100 Thermal Cycler (BioRad) ...
-
bioRxiv - Immunology 2024Quote: Ramos cells and cell lines derived from Ramos cells were grown in RPMI-1640 (Gibco 11875) supplemented with 10% FBS (Gemini) ...
-
FUS controls muscle differentiation and structure through LLPS mediated recruitment of MEF2 and ETV5bioRxiv - Neuroscience 2024Quote: ... derived myotube mitochondria were labeled with MitoTracker™ orange CMTMRos (50 nM final concentration, Thermofisher # M7510) for 40 min at 37 °C in muscle differentiation medium ...
-
bioRxiv - Cancer Biology 2024Quote: ... All 22Rv1 derived cell lines were cultured and maintained in Roswell Park Memorial Institute (Gibco RPMI) (ATCC ...
-
bioRxiv - Neuroscience 2024Quote: iPSC-derived neurons were incubated in 2.5 μM Fura-2-acetoxymethyl ester (Fura-2-AM, Invitrogen) for 50 min at 37°C ...
-
bioRxiv - Synthetic Biology 2024Quote: ... These samples were then transformed into electrocompetent DH5α cells prepared in house (derived from ThermoFisher, 18265017) and grown overnight on Luria broth (LB ...
-
bioRxiv - Neuroscience 2024Quote: ... total RNA was extracted from six-week-old iPSC-derived cortical neurons using TRIzol reagent (ThermoFisher), followed by purification with Dynabeads mRNA Purification Kit (ThermoFisher ...
-
bioRxiv - Cell Biology 2024Quote: ... Erk2 and their truncations (NC_000022.11) derived from C33A cell cDNA library were cloned into pcDNA3.1 (Invitrogen), pcDNA3.0-HA (Invitrogen ...
-
bioRxiv - Developmental Biology 2021Quote: ... double-stranded oligonucleotides containing eight BMP-responsive elements in tandem (8×BRE; AGATCCTCTGGTCACAGGATAATAATCCTGACGCCAGAAAGTCTGGAGGTC) were synthesized (GeneArt, Invitrogen) and introduced into the pNL3.2[Nluc_minP] vector (Promega) ...
-
bioRxiv - Physiology 2020Quote: ... SgRNA elements with the U6 promoter were amplified and subsequently cloned into pAd/PL adenovirus vector (Invitrogen) for virus packaging ...
-
bioRxiv - Microbiology 2020Quote: ... The mass calibration was performed using a multi-element ICP-MS tune-up solution (Thermo Fisher Scientific). In order to ensure the quality of the ICP-MS analysis ...
-
bioRxiv - Zoology 2020Quote: ... nitrogen and sulphur were determined by dry combustion with a CNS element analyser (Thermo Scientific Flash 2000) at the Global Change Research Institute CAS ...