Labshake search
Citations for Thermo Fisher :
451 - 500 of 10000+ citations for Piggybac Transposable Element Derived 3 PGBD3 Antibody since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2024Quote: ... and 1-(3-Dimethylaminopropyl)-3-ethylcarbodiimide hydro (EDC, ThermoFisher). For BS3 crosslinking ...
-
bioRxiv - Pathology 2023Quote: ... cruzi data were normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (primers 5’ CAATGTGTCCGTCGTGGATCT 3’ and 5’GTCCTCAGTGTAGCCCAAGATG 3’, probe 5’ 6-FAM CGTGCCGCCTGGAGAAACCTGCC MGB 3’; Life Technologies, CA, USA) (Life Technologies) ...
-
bioRxiv - Cell Biology 2020Quote: ... The cells were then stained with secondary antibodies diluted 1:500 in 3% BSA and DAPI (Invitrogen D3571) for 1 h at room temperature ...
-
bioRxiv - Immunology 2021Quote: ... stained with anti-cleaved caspase 3 secondary antibody (goat anti-rabbit Alexa Fluor 647, Thermo Fisher; 1:400) and anti-Ecadherin secondary antibody (goat anti-mouse Alexa Fluor 555 ...
-
bioRxiv - Biochemistry 2021Quote: ... Immunoblotting was performed as previously described (3, 30) using mouse anti-V5 antibody (R960-25, Thermo Fisher Scientific) and rabbit anti-FLAG polyclonal antibody (F7425 ...
-
bioRxiv - Cell Biology 2021Quote: ... Primary antibody dilutions were prepared in 3% NGS in 1XPBS as follows: anti-mouse α-SMA (1A4, ThermoFisher) at 1:200 and biotinylated anti-mouse IL-1RI (JAMA-147 ...
-
bioRxiv - Neuroscience 2020Quote: ... and incubated overnight in mouse anti-Hu primary antibody at 4°C (1:200 in 3% block; Invitrogen). After three 5-min PB rinses at room temperature ...
-
bioRxiv - Cancer Biology 2021Quote: ... Coverslips were washed 3 times with PBS before the Alexa fluor secondary antibody (1 in 500) (Fisher Scientific) was added and the cells incubated for a further 1 hr at RT ...
-
bioRxiv - Bioengineering 2022Quote: ... Primary antibody dilutions were prepared in 3% NGS in 1XPBS as follows: anti-mouse α-SMA (1A4, ThermoFisher) at 1:200 ...
-
bioRxiv - Cell Biology 2022Quote: ... blocked with 3% BSA and incubated with the following primary antibodies: rabbit anti-CD31 (1:50, PA516301 Invitrogen), mouse anti-GLUT1 (1:100 ...
-
bioRxiv - Cell Biology 2022Quote: ... the cells were then stained with secondary antibodies diluted 1:500 in 3% BSA and DAPI (Invitrogen D3571) for 1 h at room temperature ...
-
bioRxiv - Neuroscience 2022Quote: ... ONs were incubated in PTwH/3% Goat serum + secondary antibody (anti-rat AlexaFluor 555 (1:500, Molecular probes), and anti-chicken AlexaFluor 633 (1:500 ...
-
bioRxiv - Neuroscience 2024Quote: ... slides were washed 3 x 10 minutes with PBS and secondary antibodies conjugated to Alexa Fluor (Molecular Probes) were diluted in blocking buffer and applied for 2 hrs at room temperature ...
-
bioRxiv - Neuroscience 2023Quote: ... slides were washed 3 times in PBS-T and incubated in secondary antibody (goat anti-rabbit 647; Invitrogen) diluted 1:1000 in PBS for 2 hours at room temperature ...
-
bioRxiv - Neuroscience 2023Quote: ... slides were washed and incubated 3 h with secondary antibodies: Alexa Fluor 488 (Anti-rabbit, 1:1000, Invitrogen, Themo Fisher Scientific ...
-
bioRxiv - Neuroscience 2023Quote: ... Tissues were then incubated with the secondary antibody (1:1000; A10520, goat anti-rabbit IgG Cyanine 3, Invitrogen) during 2 h at room temperature ...
-
bioRxiv - Molecular Biology 2023Quote: ... the anti-3×FLAG antibody used for immunoprecipitation was cross-linked to beads by dimethyl pimelimidate (Thermo Fisher). Immunoprecipitation was performed using mouse anti-FLAG M2 or mouse non-immune IgG (negative control ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were washed 3 times with PBS and incubated with an Alexa-568 conjugated secondary antibodies (ThermoFisher Scientific) for 1 hour at 37 °C ...
-
bioRxiv - Neuroscience 2023Quote: ... sections were incubated with appropriate Alexa Fluor secondary antibodies for 3 h at room temperature (1:250, Invitrogen). Sections were mounted on glass slides and coverslipped using DAPI-Fluoromount-G (Southern Biotech).
-
bioRxiv - Neuroscience 2023Quote: ... Sections were then rinsed (3×15min) in PBS and incubated in corresponding secondary antibodies (Thermo Fisher Scientific, MA) for 2h at room temperature ...
-
bioRxiv - Immunology 2024Quote: ... and stained with intracellular cytokine antibodies (Supplementary Table 3) LIVE/DEAD fixable cell staining kit (Thermofisher Scientific, USA) was used to exclude dead cells from analysis.
-
bioRxiv - Genomics 2024Quote: ... The remaining cells are resuspended in our working cell buffer solution (AMES/0.4% BSA + 3 µM ActD) and incubated with CD90.2/Thy1.2 antibody conjugated to APC (#17-0902-83; Invitrogen, Carlsbad ...
-
bioRxiv - Molecular Biology 2024Quote: ... Slides were washed 3 times in PBS-T (0.05%) and incubated with secondary antibodies and DAPI (62248 ThermoFisher) for 1 hour at RT ...
-
bioRxiv - Cell Biology 2024Quote: ... cells were washed 3 times with PBS at RT followed by incubation with the secondary antibody (Thermofisher, A11008) for 2hrs at RT followed by three washes with PBS at RT ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were washed with PBS and incubated overnight at 4°C with primary antibody solution: Antibody in IF buffer containing 3% Saponin (Fisher Scientific, Cat. No. 55-825-5100GM). Antibodies used were as follows ...
-
bioRxiv - Genetics 2021Quote: Human neural stem cells derived from H9 (WA09) human embryonic stem cells were purchased from Thermo Fisher. The cells were cultured in complete StemPro NSC SFM (Thermo Fisher ...
-
bioRxiv - Bioengineering 2020Quote: ... GM-CSF differentiated mBMDCs were cultured by growing murine bone marrow-derived cells in RPMI media (Invitrogen) with 10% characterized fetal bovine serum (HyClone ...
-
bioRxiv - Molecular Biology 2020Quote: ... Dermis- and epidermis-derived supernatants were digested with trypsin SMART Digest Beads (Thermo Fisher Scientific, MA, USA) and agitated overnight at 37°C ...
-
bioRxiv - Genomics 2020Quote: Expression cassettes consisting of the doxycycline-inducible cytomegalovirus (CMV) promoter (derived from the Invitrogen T-REx system), the intron-containing EF1α 5 UTR ...
-
bioRxiv - Neuroscience 2020Quote: NSChIPS (Human Neural Stem Cells derived from the human induced pluripotent stem (iPS) cell line) (ThermoFisher, #A3890101)
-
bioRxiv - Molecular Biology 2021Quote: Parental MCF10A cells and cell lines derived from these were grown in DMEM/F12 (Gibco, 11320–033) containing 5% horse serum (Biosera ...
-
bioRxiv - Neuroscience 2020Quote: ... Primary patient-derived GBM neurospheres (HF2303 and MSP12) were cultured in DMEM-F12 (Cat# 10565-018, Gibco) supplemented with B-27 supplement (Cat# 17504-044 ...
-
bioRxiv - Cell Biology 2021Quote: ... Amastigotes in murine bone marrow derived macrophages were grown on glass bottomed 35 mm dishes (Thermo Scientific) and imaged in FluoroBrite DMEM (Gibco ...
-
bioRxiv - Cancer Biology 2020Quote: ... Both murine and patient-derived glioma spheres were cultured in defined medium containing DMEM/F12/ Glutamax (Invitrogen) supplemented with B27 (Miltenyi Biotec) ...
-
bioRxiv - Cancer Biology 2020Quote: Patient-derived cell lines were obtained as described[8] and maintained in complete RPMI (Invitrogen, Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2020Quote: Vero E6 (Cercopithecus aethiops derived epithelial kidney) cells were grown in Dulbecco’s modified Eagle’s medium (DMEM, Gibco) which was supplemented with 2.5% heat-inactivated fetal calf serum (FCS) ...
-
bioRxiv - Immunology 2022Quote: ... BCSCs or xenograft-derived tumor cells were labeled with 20 µM cell proliferation dye eFluor450 (Thermo Fisher). 1x105 tumor cells and 1x105 γδ T cells were co-cultured for 3 h at 37°C in the presence of 1 µl α-CD107a-PE antibody (BD Biosciences) ...
-
bioRxiv - Microbiology 2020Quote: Vero E6 (Cercopithecus aethiops derived epithelial kidney) cells were grown in Dulbecco’s modified Eagle’s medium (DMEM, Gibco) which was supplemented with 2.5% heat-inactivated fetal calf serum (FCS) ...
-
bioRxiv - Microbiology 2021Quote: ... This plasmid is derived from plasmid pMV001 that has been synthesized with GeneArt Gene Synthesis (ThermoFisher Scientific). pMV001 carries the Pada-ada-alkB operon where codons encoding Ada C38 and C321 have been replaced to encode A38 and A321 ...
-
bioRxiv - Genetics 2020Quote: Dermal fibroblast cells derived from OTUD5 patients or unrelated healthy donors were grown in DMEM (Life Technologies) supplemented with 10% FCS (Gemini Bio-Products ...
-
bioRxiv - Cancer Biology 2021Quote: ... Liver mCRC patient-derived cell lines (CPP19, 30, 36 and CPP45) [24] were maintained in DMEM (Gibco) with 10% FBS ...
-
bioRxiv - Cell Biology 2021Quote: ... and derived cell lines from these were cultured in Dulbecco’s Modified Eagle Medium with GlutaMAX (Life Technologies) supplemented with 10% fetal bovine serum (Gibco ...
-
bioRxiv - Microbiology 2020Quote: Vero E6 (Cercopithecus aethiops derived epithelial kidney) cells were grown in Dulbecco’s modified Eagle’s medium (DMEM, Gibco) which was supplemented with 2.5% heat-inactivated fetal calf serum (FCS) ...
-
bioRxiv - Molecular Biology 2021Quote: Human adipose-derived stem cells (ASCs) and human microvascular endothelial cells (HMVEC) were purchased from Thermo Fisher Scientific (Carlsbad ...
-
bioRxiv - Immunology 2020Quote: HEK 293-F cells (RRID:CVCL_D603; originally derived from female human embryonic kidney cells) were obtained from Invitrogen (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2022Quote: Day (D) 13-14 differentiated CD34+-derived human megakaryocytes were washed in Phosphate-Buffered Saline (PBS, Gibco), and then resuspended as previously described to study agonist responsiveness30 ...
-
bioRxiv - Genomics 2022Quote: ... ZIP13K2-derived EN cultures were further quenched with MACS-buffer (Final DPBS, 2 mM EDTA (ThermoFisher Scientific), 0,5% BSA (Sigma-Aldrich) ...
-
bioRxiv - Immunology 2022Quote: ... Bone marrow-derived macrophages (BMDM) were differentiated over 5-7 days in DMEM (Gibco, 11960044 or 11885092), 10% FBS ...
-
bioRxiv - Cell Biology 2024Quote: ... Patient-derived cells required specialized medium consisting of 1× Advanced Dulbecco’s modified Eagle’s medium/F12 (Gibco, 12634010) supplemented with 5% FBS ...
-
bioRxiv - Bioengineering 2023Quote: CHO-K1 derived host cells (AstraZeneca, UK) were maintained in CD CHO medium (Thermo Fisher Scientific, USA) supplemented with 6mM L-Glutamine ...