Labshake search
Citations for Thermo Fisher :
401 - 450 of 10000+ citations for Oregon Green Dyes since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2022Quote: ... cells were supplemented with intracellular dyes (20 µg/mL DQ Green or DQ Red BSA (Thermo Fisher Scientific), 250 µg/mL Dextran Texas Red 70,000 MW Neutral (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2022Quote: Mosaic labelling of neuroepithelial cells was achieved with BioTracker™ 490 Green Cytoplasmic Membrane Dye (Thermo Fisher Scientific). Fixed cells were stained according to the manufacturer’s instructions for 30 minutes at room temperature.
-
bioRxiv - Cancer Biology 2022Quote: Membrane permeability changes were assessed by measurements of fluorescent dye SYTOX® Green (S7020, Thermo Fisher Scientific, USA) influx ...
-
bioRxiv - Neuroscience 2022Quote: The levels of pth2 transcripts were determined by quantitative real-time PCR (qPCR) using SYBR green dye (Invitrogen) and a CFX Connect real-time thermal cycler (Bio-Rad Laboratories ...
-
bioRxiv - Neuroscience 2022Quote: ... sections were incubated with FluoroMyelin Green Stain according to the manufacturer’s instructions (Molecular Probes, 1:300 dye dilution). Sections between Bregma 1.045 and −1.555 were employed for these analyses.
-
bioRxiv - Microbiology 2023Quote: ... The water samples were stained with the DNA-binding fluorescent dye SYBR green I (Invitrogen, final concentration 2x), vortexed and incubated for 15 minutes in the dark at 37° C ...
-
bioRxiv - Biochemistry 2022Quote: ... PCR progress was monitored by adding SYBR Green dye using StepOnePlus™ Real-Time PCR System (Applied Biosystems), and data were processed and quantified by StepOne™ Software (v2.0.2) ...
-
bioRxiv - Cell Biology 2023Quote: Melanocytes suspended in the medium were incubated with 0.5 mM Cell Tracker Green CMFDA Dye (Thermo Fisher Scientific) at 37°C for 25 min ...
-
bioRxiv - Immunology 2023Quote: Freshly isolated neutrophils were stained with CellTracker™ Green 5-chloromethylfluorescein diacetate (CMFDA) dye (Thermo Fisher scientific, USA) at 5µM in serum free RPMI-1460 (SFM ...
-
bioRxiv - Microbiology 2024Quote: ... Viral genome copies were quantified by real-time quantitative PCR (qPCR) using SYBR green dye (Thermo Fisher Scientific) and primers specific for the HCMV UL36 ORF (ACGCAAAGAGTTCCTCGTAC and TGAACATAACCACGTCCTCG) ...
-
bioRxiv - Plant Biology 2021Quote: ... and digoxigenin 11-dUTP (35S) with a Nick Translation kit (Invitrogen - Oregon, USA).
-
Bioaugmented sand filter columns provide stable removal of pesticide residue from membrane retentatebioRxiv - Microbiology 2020Quote: ... the PCR mixture contained 12 µl AccuPrime Supermix II (Invitrogen, Eugene, Oregon, US), 0.25 µM of each primer ...
-
bioRxiv - Neuroscience 2022Quote: ... secondary antibody: alexafluor donkey anti-rabbit 488 (Invitrogen, Eugene, Oregon, USA; 1:1000). Cells were deemed positively stained if the mean fluorescence intensity of the somatic area was at least two times of the background fluorescence intensity.
-
bioRxiv - Neuroscience 2022Quote: ... VGAT N-terminal antibody (rabbit polyclonal 131002, Invitrogen, Eugene, Oregon, USA; 1:1000); secondary antibody ...
-
bioRxiv - Microbiology 2022Quote: ... Proteins were separated in 4-12% Novex Tris-Glycine gels (Invitrogen, Eugene, Oregon), and stained with Coomassie Brilliant Blue R-250 or SYPRO ruby (Invitrogen ...
-
bioRxiv - Genetics 2023Quote: ... genomic DNA was quantified using Qubit® fluorometric quantitation (ThermoFisher Scientific, Oregon, USA) and normalized to 0.2 ng/μL.
-
bioRxiv - Plant Biology 2023Quote: Pluronic acid F-127: (Molecular Probes/Thermo Fisher Scientific, Oregon, USA, cat. #: P6867), a 20% stock solution in DMSO was stored in 100 µL aliquots at RT.
-
bioRxiv - Plant Biology 2023Quote: ... and quantified using a Qubit High Sensitivity (HS) assay (ThermoFisher Scientific, Oregon, USA). If the DNA had low concentrations ...
-
bioRxiv - Microbiology 2021Quote: ... 20 µl resuspended parasite culture was incubated with dihydroethidium (5 µg/ml, Cayman) and SYBR Green I dye (0.25 x dilution, Invitrogen) in a final volume of 100 µl medium for 20 min at RT protected from light ...
-
bioRxiv - Microbiology 2021Quote: ... parasites were fixed with 0.1% glutaraldehyde/PBS and stained with SYBR Green I dye (1:10,000 dilution in PBS; Life Technologies) for 30 min at 37°C ...
-
bioRxiv - Bioengineering 2020Quote: ... the media was changed to remove the melted gelatin and label cells with CellTracker™ Green CMFDA Dye (Invitrogen) and 2 μg/mL Hoechst 33342 dye (ThermoFisher Scientific ...
-
bioRxiv - Immunology 2020Quote: ... pelleted by centrifugation and resuspended in 500 ul of MACS buffer + 2 ul of SYTOX Green viability dye (ThermoFisher). Cells were sorted on FACS Aria II SORP instrument using 100 um nozzle and 20 psi pressure ...
-
bioRxiv - Microbiology 2022Quote: ... 20 μl resuspended parasite culture was incubated with dihydroethidium (5 μg/ml, Cayman) and SYBR Green I dye (0.25 x dilution, Invitrogen) in a final volume of 100 μl medium for 20 min at RT protected from light ...
-
bioRxiv - Cancer Biology 2022Quote: Cells were resuspended in PBS and LIVE/DEADTM Fixable Near-IR or Green dead cell dyes (Thermo Fisher Scientific) and incubated 15 min at RT in the dark for cell viability assessment ...
-
bioRxiv - Microbiology 2019Quote: Stationary-phase reductase and electron transport chain activities were measured with Redox Sensor Green (RSG) dye (ThermoFisher, catalog# B34954) according to manufacturer’s instructors ...
-
bioRxiv - Neuroscience 2020Quote: ... cells were incubated for 20 min at room temperature with SYTO RNASelect green fluorescent dye in PBS (1:10.000, S-32703, Invitrogen). Samples were washed with PBS and mounted with ProLong Gold antifade reagent ...
-
bioRxiv - Microbiology 2023Quote: ... 20 μl resuspended parasite culture were incubated with dihydroethidium (5 μg/ml, Cayman) and SYBR Green I dye (0.25 x dilution, Invitrogen) in a final volume of 100 μl medium for 20 min at room temperature protected from light ...
-
bioRxiv - Immunology 2024Quote: ... CAR T cells were stained with either Calcein Green or Cell Proliferation Dye eFluor670 (Thermo Fisher 65-0840-85) (same procedure used for motility assay ...
-
bioRxiv - Microbiology 2024Quote: ... and a 488nm laser with a 530/30nm filter to excite BacLight Green Bacterial Stain (bacteria-specific dye, Invitrogen), as were forward (FSC ...
-
bioRxiv - Cancer Biology 2021Quote: ... cell media was exchanged for media containing lethal compounds and 0.022 μM of the viability dye SYTOX Green (SG, Cat # S7020, Life Technologies). Cells were then imaged at 4 h intervals for ≥ 48 h using the Essen IncuCyte ZOOM live cell analysis system (Essen BioSciences) ...
-
bioRxiv - Neuroscience 2021Quote: ... each sample was run in triplicate using 10 µL total volume per well with the following components: PowerUp Sybr green dye (ThermoFisher, containing ROX dye for passive reference) ...
-
bioRxiv - Neuroscience 2021Quote: ... each sample was run in triplicate using 10 μL total volume per well with the following components: PowerUp Syber green dye (ThermoFisher, containing ROX dye for passive reference) ...
-
bioRxiv - Neuroscience 2020Quote: ... mRNA expression levels were assessed by quantitative real-time PCR using SYBR Green dye-based PCR amplification (Thermo Fisher Scientific) and the QuantStudio 3 detection system (Applied biosystems) ...
-
bioRxiv - Microbiology 2020Quote: ... Parasite viability was assessed 66 hours later in cycle 2 by flow cytometry analysis of parasite cultures stained with Syber Green I and MitoTracker Deep Red dyes (Invitrogen). Flow cytometry analysis was carried on a MACSQuant® Analyzer 10.
-
bioRxiv - Microbiology 2021Quote: ... to label the glycocalyx (GX) and for 3 min with CellMask Green plasma membrane live cell imaging dye (Life Technologies) prepared in endothelial growth medium to label ECs ...
-
bioRxiv - Neuroscience 2020Quote: ... each sample was run in triplicate using 10uL total volume per well with the following components: PowerUp Syber green dye (ThermoFisher), forward and reverse primers (Eton Biosciences Inc. ...
-
Interleukin 4 controls the role of macrophages in pulmonary metastatic tumor cell seeding and growthbioRxiv - Cancer Biology 2021Quote: ... E0771-LG cells and Met-1 cells were labeled with CellTracker™ Green CMFDA Dye (Thermo Fisher Scientific, New York) following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: ... each sample was run in triplicate using 10 µL total volume per well with the following components: PowerUp Syber green dye (ThermoFisher, containing ROX dye for passive reference) ...
-
bioRxiv - Immunology 2022Quote: ... and the housekeeping gene GAPDH using the indicated primer pairs and the PowerUp SYBR Green Master Mix dye (Applied Biosystems) on a QuantStudio 5 Real-Time PCR system (ThermoFisher) ...
-
bioRxiv - Microbiology 2023Quote: ... qPCR analysis was performed using a Corbett Life Science Rotor Gene 6000 and SYBR Green as dye (2X KAPA SYBR FAST, Invitrogen). Real-time PCR was carried out as follows ...
-
bioRxiv - Cancer Biology 2023Quote: Mitochondria content was analyzed using the mean fluorescent intensity of mitochondria structures stained with the Mitotracker green dye (Thermofisher scientific). Mean fluorescent intensity of each image was measured using ImageJ and normalized to the image area ...
-
bioRxiv - Microbiology 2023Quote: ... knockdown or induction of target genes was quantified by SYBR green dye-based quantitative real-time PCR (Applied Biosystems 4309155) on a Quantstudio System 5 (Thermo Fisher A28140 ...
-
bioRxiv - Neuroscience 2023Quote: ... Cells were incubated for 20 min at room temperature with 500 nM SYTO RNA Select green fluorescent dye in PBS (Invitrogen). Cells were washed three times with PBS and mounted with Prolong Gold Antifade mounting medium with DAPI (Invitrogen).
-
bioRxiv - Biophysics 2023Quote: ... cells were incubated with a dye master mix containing CellEventTM Caspase 3/7 Green Detection Reagent (ThermoFisher Scientific, 1:1000) and Zombie NIR fixable viability stain (BioLegend ...
-
bioRxiv - Genetics 2020Quote: Dyes: CFSE and DDAO cell tracker dyes (both Invitrogen), LIVE/DEAD near-IR dye (Life Technologies) ...
-
bioRxiv - Bioengineering 2023Quote: ... 10 μL of membrane-sensitive dye (Fluovolt dye, Invitrogen) was mixed with 100 μl of 100× Pluronic™ surfactant polyols (PowerLoad Concentrate ...
-
bioRxiv - Biophysics 2019Quote: ... Fluorescent Alexa Fluor 488 actin conjugate is obtained from Molecular Probes (Eugene, Oregon, USA). Porcine Arp2/3 complex is purchased from Cytoskeleton and used with no further purification ...
-
bioRxiv - Neuroscience 2020Quote: ... the probe was coated with Vybrant® DiI cell-labelling solution (Invitrogen, Oregon, USA) to allow visualizing the probe insertion track post-mortem through histological procedures ...
-
bioRxiv - Neuroscience 2020Quote: ... the probe was coated with Vybrant® DiI cell-labeling solution (Invitrogen, Oregon, USA), to allow visualizing the probe insertion track post-mortem ...
-
bioRxiv - Genetics 2022Quote: ... We quantified gDNA with a Qubit® 3.0 fluorometer (Life Technologies, Eugene, Oregon, USA) and selected gDNA samples with the highest concentrations.