Labshake search
Citations for Thermo Fisher :
451 - 500 of 10000+ citations for Oregon Green Dyes since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... and stained with Coomassie Brilliant Blue R-250 or SYPRO ruby (Invitrogen, Eugene, Oregon) and visualized using a FluorChemE imager (Protein Simple ...
-
bioRxiv - Neuroscience 2023Quote: ... for staining the nuclei (P36930, Invitrogen by Thermo Fisher Scientific, Life Technologies, Oregon, USA).
-
bioRxiv - Biophysics 2023Quote: ... Motility plates were imaged on and iBright CL1500 system (Thermo Fisher Scientific, Hillsboro, Oregon) and evaluated with ImageJ (37) ...
-
bioRxiv - Cell Biology 2019Quote: ... Real time PCR was performed using Platinum SYBR green qPCR SuperMix-UDG kit with ROX reference dye (Thermo Fisher Scientific, 11733038) and a StepOne plus PCR system (Applied Biosystems) ...
-
bioRxiv - Molecular Biology 2021Quote: ... pre-reaction) or 3 µL of freshly prepared 10-fold dilution of SYBR Green I dye post-reaction(Invitrogen, Waltham, MA) after amplification of each LAMP reaction (Fig 1) ...
-
bioRxiv - Cancer Biology 2019Quote: ... Quantitative PCR (qPCR) was performed in duplicate using the FAST SYBR Green dye on the StepOnePlus real-time PCR system (Applied Biosystems). Primer sequences are listed in (Supplementary Table 3).
-
bioRxiv - Immunology 2019Quote: ... were seeded onto 96-well plates in the presence of cell-impermeable SYTOX Green DNA-binding dye (500 nM) (Thermo Fisher). Cells were left untreated ...
-
bioRxiv - Biochemistry 2020Quote: ... The cDNA was purified as previously described (14) and amplified in the presence of 1x SYBR Green 1 dye (Thermo Fisher) using primers P6 and P7 (Table S1) ...
-
bioRxiv - Cancer Biology 2020Quote: ... followed by the addition of live cell dyes in NIM with 2µg/ml Hoechst 33342: 1:1000 Lysosensor Green DND-189 (Thermo Fisher #7535), 1:2000 Cyto-ID Autophagy Detection dye (ENZO # ENZ-51031) ...
-
bioRxiv - Neuroscience 2020Quote: ... Dissociated DRG neurons (see above) were incubated in CellTracker Green Dye (1: 1000 diluted in DRG culture media, Thermo Fisher, C7025) for 15 min at room temperature (21 °C) ...
-
bioRxiv - Microbiology 2021Quote: ... stocks were diluted to 108 phages/mL in SM buffer and allowed to incubate with SYBR green dye (1:1000) (Molecular Probes) in the dark at 4°C for 1 hour ...
-
bioRxiv - Cell Biology 2020Quote: ... DNA level in samples was measured by SYBR Green dye-based qPCR assay using a PRISM 7300 sequence detection system (Applied Biosystems) as described previously (Nakahira PLoS Med ...
-
bioRxiv - Immunology 2022Quote: The 2×105/ml cells were suspended in 100 μl PBS and stained using 1:1000 dye mix (CellTracker velvet, LysoTracker green and DAPI, from Thermo Fisher) at 37 ℃ for 15 min ...
-
bioRxiv - Neuroscience 2019Quote: ... The PCR amplification was performed using Power SYBR green dye and ViiA 7 Real-Time PCR system (Applied Biosystems, Carlsbad, CA). All primer sets used in the qPCR analysis (Table 3 ...
-
bioRxiv - Microbiology 2020Quote: ... and parasitaemia as well as DNA content were measured by flow cytometry using the nuclear dye SYBR Green (1:10,000; Thermo Fisher Scientific). For invasion assays ...
-
bioRxiv - Cell Biology 2021Quote: ... The samples were analysed in triplicate with SYBR GREEN dye (Primer Design Precision Master mix) on an ABI StepOnePlus quantitative PCR instrument (Applied Biosystems). The comparative Ct method was employed to measure amplification of specific mRNAs vs ...
-
bioRxiv - Bioengineering 2022Quote: ... The ability of coated surfaces to bind extracellular DNA was evaluated by applying the active surface of the experimental discs stained with the cell impermeant nuclear dye Sytox Green (S7020, Invitrogen, France) upon a 3-minute contact with human neutrophils stimulated with nigericin (which trigger the formation of NETs 14).
-
bioRxiv - Neuroscience 2023Quote: ... qPCR reaction was performed using Fast SYBR Green dye (Thermo) in technical duplicates for each sample on a Step One Plus Real time PCR system (Life Technologies) to determine relative expression of selected mRNA transcripts (denaturation for 5 min at 95 °C ...
-
bioRxiv - Neuroscience 2023Quote: ... and diluted to a working titer of 1×1013 (to enable a longer period of optimal expression) with 1% filtered Fast Green FCF dye (Fisher Scientific). We injected (see below ...
-
bioRxiv - Cell Biology 2023Quote: ... was conducted on the cDNA using gag-specific primers (GGACCAAAGGAACCCTTTAGAGA; GGACCAACAAGGTTTCTGTCATC) in the presence of nucleic acid dye SYBR Green (Invitrogen, Europe). Standard curves were generated using cDNA synthesized from in vitro transcribed RNA ...
-
bioRxiv - Cell Biology 2023Quote: ... Twenty ng cDNA (relative to RNA amount) was subjected to quantitative PCR with a SYBR green dye–based PCR amplification and detection master mix (ThermoFisher Scientific) in Eppendorf MarsterCycler gradient S machine (Eppendorf ...
-
bioRxiv - Cell Biology 2023Quote: ... and then HCS LipidTOX™ green neutral lipid dye at 1:200 dilution (InvitrogenTM by Thermo Fisher Scientific, cat. nr H34475) was added ...
-
bioRxiv - Cancer Biology 2024Quote: ... medium from the bottom well was aspirated and replaced with 2 μg/ml Calcein-green AM dye (Thermo Fisher Scientific; C3100MP) in 1× HBSS (Gibco ...
-
bioRxiv - Immunology 2021Quote: ... and cellular dyes (cell proliferation dye eFluor670; Thermo Fisher Scientific) to be used as target cells ...
-
bioRxiv - Microbiology 2021Quote: ... and cellular dyes (cell proliferation dye eFluor670; Thermo Fisher Scientific) and subsequently used as target cells ...
-
bioRxiv - Cancer Biology 2023Quote: ... and nuclear dye of SYTOTM83 dye (250 nM, Thermofisher # S11364). Based on fluorescence imaging ...
-
bioRxiv - Cell Biology 2021Quote: ... Hoechst dye (Invitrogen) was added for 30 min ...
-
Activity regulates a cell type-specific mitochondrial phenotype in zebrafish lateral line hair cellsbioRxiv - Cell Biology 2022Quote: TMRE dye (Invitrogen) was prepared according to manufacturer’s specifications ...
-
bioRxiv - Developmental Biology 2020Quote: ... ToPro dye (Invitrogen) was incorporated at a 1:1000 concentration for 7-10 minutes to visualize nuclei of tissues ...
-
bioRxiv - Immunology 2022Quote: ... Viability dye (Invitrogen) was routinely used to exclude dead cells ...
-
bioRxiv - Cell Biology 2020Quote: ... coverslips were mounted onto microscope slides using anti-fade medium (Molecular Probes-Invitrogen, Oregon, USA), and visualized with a Zeiss AX10 Observer A1 inverted microscope ...
-
bioRxiv - Cell Biology 2020Quote: ... coverslips were mounted onto microscope slides using anti-fade medium (Molecular Probes-Invitrogen, Oregon, USA), and visualized with a Zeiss AX10 Observer A1 inverted microscope ...
-
bioRxiv - Neuroscience 2020Quote: ... and then mounted with SlowFade Gold Antifade Reagent with DAPI (Molecular Probes, Eugene, Oregon, USA).
-
bioRxiv - Cell Biology 2021Quote: ... AlexaFluor-conjugated secondary antibodies (diluted 1:500 in PBS/2%BSA) (LIFE TECHNOLOGIES, Oregon, USA) were added and incubated for 1 h at room temperature ...
-
bioRxiv - Molecular Biology 2021Quote: Total RNA was extracted from 40 adults of Oregon-R using TRIzol reagent (Thermo Fisher) followed by chloroform purification and isopropanol precipitation ...
-
bioRxiv - Systems Biology 2020Quote: ... The biofilm was stained by flowing 1 mL of Live/Dead (Life Technologies, Oregon, USA) staining solution (1.5 μL Syto9 + 1.5 μL propidium iodide in 1 mL of sterile demineralized water ...
-
bioRxiv - Biophysics 2020Quote: ... and fluorescently labeled with a cell tracer (Oregon 488; Thermo Fisher Scientific, Waltham, MA, USA), according to the manufacturer protocol ...
-
bioRxiv - Biochemistry 2022Quote: ... Cells (70–80% confluent) were loaded with 2 μM Fura 2 AM (Molecular Probes, Oregon) in culture medium for 20 min at 37 °C in a humidified atmosphere of 95% O2 and 5% CO2 ...
-
bioRxiv - Developmental Biology 2021Quote: ... Secondary antibody incubation was performed with Alexa-conjugated antibodies (Life Technologies Corporation, Eugene, Oregon, USA). Tissue was mounted with Fluoromount G mounting medium (Life Technologies Corporation).
-
bioRxiv - Genetics 2022Quote: ... We quantified the ddRAD libraries on the Qubit 3.0 fluorometer (Life Technologies, Eugene, Oregon, USA) and assessed the size fragments on a Tape Station 2200 (Agilent ...
-
bioRxiv - Biophysics 2023Quote: Imaging was performed on a Titan Krios G3i FEG-TEM (Thermo Fisher Scientific, Hillsboro, Oregon) operated at 300 kV ...
-
bioRxiv - Biophysics 2020Quote: ... Excess dye was removed using Pierce dye removal columns (ThermoFisher, 22858). JF646-labeled proteins were then diluted to 500 nM with Imaging Buffer (MB supplemented with 15 mM glucose ...
-
bioRxiv - Immunology 2022Quote: ... and a cellular dye (cell proliferation dye eFluor670; Thermo Fisher Scientific) and subsequently used as target cells ...
-
bioRxiv - Immunology 2021Quote: ... and a cellular dye (cell proliferation dye eFluor670; Thermo Fisher Scientific) and subsequently used as target cells ...
-
bioRxiv - Biochemistry 2022Quote: ... After dye removal using Pierce Dye Removal Columns (Thermo Scientific #22858), protein was determined by Bradford Assay ...
-
bioRxiv - Microbiology 2022Quote: ... and a cellular dye (cell proliferation dye eFluor670; Thermo Fisher Scientific) and subsequently used as target cells ...
-
bioRxiv - Microbiology 2021Quote: We detected fungal cells with compromised cell membranes by recording the fluorescence of the DNA-binding dye SYTOX green (Molecular Probes, USA). Permeabilization of the fungal membrane allows the dye to cross the membranes and to intercalate into the DNA ...
-
bioRxiv - Microbiology 2020Quote: ... Quantitative real-time PCR (RT-qPCR) was performed using SYBR Green dye-based assay in a QuantStudio 3 Real-Time PCR system (Thermo Fisher Scientific) with the following reaction conditions ...
-
bioRxiv - Plant Biology 2021Quote: ... a 1-mL aliquot of BY-2 cell culture was mixed with CellTracker Green CMFDA Dye (C7025, Thermo Fisher Scientific, Tokyo, Japan) at 5 μM and incubated for 30 min at 26°C with agitation ...
-
bioRxiv - Immunology 2020Quote: ... Sections were subsequently immunostained with species-specific secondary antibodies coupled to Alexa Fluor 488 (green) or Alexa Fluor 594 (red) dyes (Thermo Fisher Scientific). Cell nuclei were detected using DAPI ...